Morpholino

MO3-wnt2

ID
ZDB-MRPHLNO-110916-6
Name
MO3-wnt2
Previous Names
  • MO acc-wnt2 (1)
Target
Sequence
5' - GCCCATGTACCTGCATAAAGAGATG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking Morpholino.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-wnt2
Phenotype
Phenotype resulting from MO3-wnt2
Phenotype of all Fish created by or utilizing MO3-wnt2
Phenotype Fish Conditions Figures
swim bladder decreased size, abnormal WT + MO3-wnt2 standard conditions Fig. 6 with image from Poulain et al., 2011
swim bladder development having decreased processual parts cell population proliferation, abnormal WT + MO3-wnt2 standard conditions Fig. 6 with image from Poulain et al., 2011
liver decreased size, abnormal WT + MO3-wnt2 standard conditions Fig. 2 with image from Poulain et al., 2011
liver decreased size, abnormal jh1Tg + MO3-wnt2 standard conditions Fig. 1 with image from Poulain et al., 2011
liver hypoplastic, abnormal jh1Tg + MO3-wnt2 standard conditions Fig. 1 with image from Poulain et al., 2011
liver development having decreased processual parts cell population proliferation, abnormal jh1Tg + MO3-wnt2 standard conditions Fig. 1 with image from Poulain et al., 2011
liver decreased size, abnormal s854Tg + MO3-wnt2 standard conditions Fig. 1 with imageFig. 2 with image from Poulain et al., 2011
liver hypoplastic, abnormal s854Tg + MO3-wnt2 standard conditions Fig. 1 with image from Poulain et al., 2011
pancreatic B cell mislocalised, abnormal s854Tg + MO3-wnt2 standard conditions Fig. 1 with image from Poulain et al., 2011
liver development having decreased processual parts cell population proliferation, abnormal s854Tg + MO3-wnt2 standard conditions Fig. 1 with image from Poulain et al., 2011
liver decreased size, abnormal gz2Tg; gz4Tg; s854Tg + MO3-wnt2 standard conditions Fig. 2 with image from Poulain et al., 2011
liver decreased size, abnormal wnt2bbs403/s403 + MO3-wnt2 standard conditions Fig. 2 with image from Poulain et al., 2011
swim bladder development having decreased processual parts cell population proliferation, abnormal wnt2bbs403/s403 + MO3-wnt2 standard conditions Fig. 6 with image from Poulain et al., 2011
swim bladder absent, abnormal wnt2bbs403/s403 + MO3-wnt2 standard conditions Fig. 6 with image from Poulain et al., 2011
liver absent, abnormal wnt2bbs403/s403 + MO3-wnt2 standard conditions Fig. 2 with imageFig. 6 with image from Poulain et al., 2011
swim bladder development having decreased processual parts cell population proliferation, abnormal wnt2bbs404/s404 + MO3-wnt2 standard conditions Fig. 6 with image from Poulain et al., 2011
swim bladder absent, abnormal wnt2bbs404/s404 + MO3-wnt2 standard conditions Fig. 6 with image from Poulain et al., 2011
liver absent, abnormal wnt2bbs404/s404 + MO3-wnt2 standard conditions Fig. 2 with imageFig. 6 with image from Poulain et al., 2011
liver decreased size, abnormal wnt2bbs404/s404 + MO3-wnt2 standard conditions Fig. 2 with image from Poulain et al., 2011
liver decreased size, abnormal WT + MO1-fzd5 + MO3-wnt2 standard conditions Fig. 5 with image from Poulain et al., 2011
gall bladder absent, abnormal wnt2bbs403/s403; gz2Tg; gz4Tg; s854Tg + MO3-wnt2 standard conditions Fig. 2 with image from Poulain et al., 2011
liver development having decreased processual parts cell population proliferation, abnormal wnt2bbs403/s403; gz2Tg; gz4Tg; s854Tg + MO3-wnt2 standard conditions Fig. 2 with image from Poulain et al., 2011
gall bladder decreased size, abnormal wnt2bbs403/s403; gz2Tg; gz4Tg; s854Tg + MO3-wnt2 standard conditions Fig. 2 with image from Poulain et al., 2011
extrahepatic duct decreased size, abnormal wnt2bbs403/s403; gz2Tg; gz4Tg; s854Tg + MO3-wnt2 standard conditions Fig. 2 with image from Poulain et al., 2011
extrahepatic duct absent, abnormal wnt2bbs403/s403; gz2Tg; gz4Tg; s854Tg + MO3-wnt2 standard conditions Fig. 2 with image from Poulain et al., 2011
liver absent, abnormal wnt2bbs403/s403; gz2Tg; gz4Tg; s854Tg + MO3-wnt2 standard conditions Fig. 2 with image from Poulain et al., 2011
liver decreased size, abnormal wnt2bbs403/s403; s854Tg + MO3-wnt2 standard conditions Fig. 2 with image from Poulain et al., 2011
liver hypoplastic, abnormal wnt2bbs403/s403; s854Tg + MO3-wnt2 standard conditions Fig. 2 with image from Poulain et al., 2011
liver development having decreased processual parts cell population proliferation, abnormal wnt2bbs403/s403; s854Tg + MO3-wnt2 standard conditions Fig. 2 with image from Poulain et al., 2011
extrahepatic duct decreased size, abnormal wnt2bbs403/s403; s854Tg + MO3-wnt2 standard conditions Fig. 2 with image from Poulain et al., 2011
liver development having decreased processual parts cell population proliferation, abnormal wnt2bbs404/s404; gz2Tg; gz4Tg; s854Tg + MO3-wnt2 standard conditions Fig. 2 with image from Poulain et al., 2011
liver absent, abnormal wnt2bbs404/s404; gz2Tg; gz4Tg; s854Tg + MO3-wnt2 standard conditions Fig. 2 with image from Poulain et al., 2011
extrahepatic duct decreased size, abnormal wnt2bbs404/s404; gz2Tg; gz4Tg; s854Tg + MO3-wnt2 standard conditions Fig. 2 with image from Poulain et al., 2011
gall bladder absent, abnormal wnt2bbs404/s404; gz2Tg; gz4Tg; s854Tg + MO3-wnt2 standard conditions Fig. 2 with image from Poulain et al., 2011
gall bladder decreased size, abnormal wnt2bbs404/s404; gz2Tg; gz4Tg; s854Tg + MO3-wnt2 standard conditions Fig. 2 with image from Poulain et al., 2011
extrahepatic duct absent, abnormal wnt2bbs404/s404; gz2Tg; gz4Tg; s854Tg + MO3-wnt2 standard conditions Fig. 2 with image from Poulain et al., 2011
liver absent, abnormal wnt2bbs404/s404; s854Tg + MO3-wnt2 standard conditions Fig. 2 with image from Poulain et al., 2011
extrahepatic duct decreased size, abnormal wnt2bbs404/s404; s854Tg + MO3-wnt2 standard conditions Fig. 2 with image from Poulain et al., 2011
liver decreased size, abnormal wnt2bbs404/s404; s854Tg + MO3-wnt2 standard conditions Fig. 2 with image from Poulain et al., 2011
Citations