Morpholino
MO1-mipa
- ID
- ZDB-MRPHLNO-110824-5
- Name
- MO1-mipa
- Previous Names
- None
- Target
- Sequence
-
5' - AACTCCCACATGGCTGCAAAAAGTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mipa
No data available
Phenotype
Phenotype resulting from MO1-mipa
1 - 4 of 4
Phenotype of all Fish created by or utilizing MO1-mipa
1 - 5 of 8 Show all
Citations
- Jones, J.L., Corbett, M.A., Yeaman, E., Zhao, D., Gecz, J., Gasperini, R.J., Charlesworth, J.C., Mackey, D.A., Elder, J.E., Craig, J.E., Burdon, K.P. (2021) A 127 kb truncating deletion of PGRMC1 is a novel cause of X-linked isolated paediatric cataract. European journal of human genetics : EJHG. 29(8):1206-1215
- Clemens, D.M., Németh-Cahalan, K.L., Trinh, L., Zhang, T., Schilling, T.F., and Hall, J.E. (2013) In vivo Analysis of Aquaporin 0 Function in Zebrafish: Permeability Regulation is Required for Lens Transparency. Investigative ophthalmology & visual science. 54(7):5136-5143
- Posner, M., Skiba, J., Brown, M., Liang, J.O., Nussbaum, J., and Prior, H. (2013) Loss of the small heat shock protein alphaA-crystallin does not lead to detectable defects in early zebrafish lens development. Experimental Eye Research. 116:227-33
- Froger, A., Clemens, D.M., Kalman, K., Németh-Cahalan, K.L., Schilling, T.F., and Hall, J.E. (2010) Two Distinct Aquaporin 0s are Required for Development and Transparency of the Zebrafish Lens. Investigative ophthalmology & visual science. 51(12):6582-6592
1 - 4 of 4
Show