Morpholino

MO1-irx3b

ID
ZDB-MRPHLNO-110815-1
Name
MO1-irx3b
Previous Names
None
Target
Sequence
5' - ACCGGGAGGACTGCGGGGAAACTCG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Targets 5'UTR.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-irx3b
No data available
Phenotype
Phenotype resulting from MO1-irx3b
Phenotype Fish Figures
corpuscles of Stannius increased size, abnormal TU + MO1-irx3b Fig. 4 with image from Naylor et al., 2018
corpuscles of Stannius embryonic organ development decreased process quality, abnormal TU + MO1-irx3b Fig. 5 with image from Naylor et al., 2018
corpuscles of Stannius specification of animal organ identity decreased occurrence, abnormal TU + MO1-irx3b Fig. 5 with image from Naylor et al., 2018
corpuscles of Stannius specification of animal organ identity increased occurrence, abnormal TU + MO1-irx3b Fig. 4 with image from Naylor et al., 2018
pronephric distal early tubule slc12a1 expression absent, abnormal TU + MO1-irx3b Fig. 4 with image from Naylor et al., 2018
pronephric distal early tubule atp1a1a.4 expression decreased amount, abnormal TU + MO1-irx3b Fig. 5 with image from Naylor et al., 2018
pronephric distal early tubule cdh17 expression decreased amount, abnormal TU + MO1-irx3b Fig. 4 with image from Naylor et al., 2018
pronephric distal early tubule slc12a1 expression decreased amount, abnormal TU + MO1-irx3b Fig. 4 with image from Naylor et al., 2018
pronephric distal early tubule slc12a1 expression decreased distribution, abnormal TU + MO1-irx3b Fig. 4 with image from Naylor et al., 2018
pronephric distal early tubule decreased length, abnormal TU + MO1-irx3b Fig. 4 with image from Naylor et al., 2018
pronephric distal early tubule stc1 expression increased distribution, abnormal TU + MO1-irx3b Fig. 4 with image,  Fig. 5 with image from Naylor et al., 2018
pronephric distal early tubule stc1 expression mislocalised, abnormal TU + MO1-irx3b Fig. 4 with image,  Fig. 5 with image from Naylor et al., 2018
pronephric distal early tubule poorly differentiated, abnormal TU + MO1-irx3b Fig. 6 from Naylor et al., 2013
pronephric distal late tubule increased width, abnormal nz1Tg + MO1-irx3b Fig. 5 with image from Naylor et al., 2018
pronephric distal late tubule epithelial cell increased length, abnormal nz1Tg + MO1-irx3b Fig. 5 with image from Naylor et al., 2018
pronephric nephron tubule development decreased process quality, abnormal TU + MO1-irx3b Fig. 6 from Naylor et al., 2013
pronephric proximal straight tubule decreased width, abnormal nz1Tg + MO1-irx3b Fig. 5 with image from Naylor et al., 2018
pronephric proximal straight tubule epithelial cell increased length, abnormal nz1Tg + MO1-irx3b Fig. 5 with image from Naylor et al., 2018
Phenotype of all Fish created by or utilizing MO1-irx3b
Phenotype Fish Conditions Figures
corpuscles of Stannius embryonic organ development decreased process quality, abnormal TU + MO1-irx3b standard conditions Fig. 5 with image from Naylor et al., 2018
corpuscles of Stannius specification of animal organ identity increased occurrence, abnormal TU + MO1-irx3b standard conditions Fig. 4 with image from Naylor et al., 2018
pronephric distal early tubule stc1 expression mislocalised, abnormal TU + MO1-irx3b chemical treatment by environment: blebbistatin Fig. 5 with image from Naylor et al., 2018
corpuscles of Stannius specification of animal organ identity decreased occurrence, abnormal TU + MO1-irx3b standard conditions Fig. 5 with image from Naylor et al., 2018
corpuscles of Stannius increased size, abnormal TU + MO1-irx3b standard conditions Fig. 4 with image from Naylor et al., 2018
pronephric distal early tubule stc1 expression increased distribution, abnormal TU + MO1-irx3b chemical treatment by environment: blebbistatin Fig. 5 with image from Naylor et al., 2018
pronephric distal early tubule cdh17 expression decreased amount, abnormal TU + MO1-irx3b standard conditions Fig. 4 with image from Naylor et al., 2018
pronephric distal early tubule slc12a1 expression decreased amount, abnormal TU + MO1-irx3b standard conditions Fig. 4 with image from Naylor et al., 2018
corpuscles of Stannius embryonic organ development decreased process quality, exacerbated TU + MO1-irx3b chemical treatment by environment: blebbistatin Fig. 5 with image from Naylor et al., 2018
pronephric distal early tubule stc1 expression increased distribution, abnormal TU + MO1-irx3b standard conditions Fig. 4 with image,  Fig. 5 with image from Naylor et al., 2018
pronephric distal early tubule atp1a1a.4 expression decreased amount, abnormal TU + MO1-irx3b standard conditions Fig. 5 with image from Naylor et al., 2018
pronephric distal early tubule slc12a1 expression decreased distribution, abnormal TU + MO1-irx3b standard conditions Fig. 4 with image from Naylor et al., 2018
pronephric distal early tubule decreased length, abnormal TU + MO1-irx3b standard conditions Fig. 4 with image from Naylor et al., 2018
pronephric nephron tubule development decreased process quality, abnormal TU + MO1-irx3b standard conditions Fig. 6 from Naylor et al., 2013
pronephric distal early tubule poorly differentiated, abnormal TU + MO1-irx3b standard conditions Fig. 6 from Naylor et al., 2013
pronephric distal early tubule slc12a1 expression absent, abnormal TU + MO1-irx3b standard conditions Fig. 4 with image from Naylor et al., 2018
pronephric distal early tubule stc1 expression mislocalised, abnormal TU + MO1-irx3b standard conditions Fig. 4 with image,  Fig. 5 with image from Naylor et al., 2018
pronephric distal early tubule absent, abnormal TU + MO1-irx3b + MO2-irx3b standard conditions Fig. 7 with image from Wingert et al., 2011
pronephric duct proximal region increased length, abnormal TU + MO1-irx3b + MO2-irx3b standard conditions Fig. 7 with image from Wingert et al., 2011
pronephric distal late tubule epithelial cell increased length, abnormal nz1Tg + MO1-irx3b standard conditions Fig. 5 with image from Naylor et al., 2018
pronephric distal late tubule increased width, abnormal nz1Tg + MO1-irx3b standard conditions Fig. 5 with image from Naylor et al., 2018
corpuscles of Stannius embryonic organ development decreased process quality, abnormal nz1Tg + MO1-irx3b standard conditions Fig. 5 with image from Naylor et al., 2018
pronephric proximal straight tubule decreased width, abnormal nz1Tg + MO1-irx3b standard conditions Fig. 5 with image from Naylor et al., 2018
pronephric proximal straight tubule epithelial cell increased length, abnormal nz1Tg + MO1-irx3b standard conditions Fig. 5 with image from Naylor et al., 2018
pronephric distal late tubule increased length, abnormal aldh1a2nz15/nz15 + MO1-irx3b + MO2-irx3b (TU) standard conditions Fig. 7 with image from Wingert et al., 2011
pronephric distal early tubule absent, abnormal aldh1a2nz15/nz15 + MO1-irx3b + MO2-irx3b (TU) standard conditions Fig. 7 with image from Wingert et al., 2011
pronephric duct proximal region increased length, abnormal aldh1a2nz15/nz15 + MO1-irx3b + MO2-irx3b (TU) standard conditions Fig. 7 with image from Wingert et al., 2011
Citations