Morpholino

MO1-mmp25b

ID

ZDB-MRPHLNO-110727-5

Name

MO1-mmp25b

Previous Names

None

Target

mmp25b (1)

Sequence

5' - AAACTCATGTGTGTGCTGGTGGAAA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

translation-blocking morpholino targeting the 5' UTR.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-mmp25b

No data available

Phenotype

Phenotype resulting from MO1-mmp25b

Phenotype	Fish	Figures
cranial nerve V malformed, abnormal	rw0Tg + MO1-mmp25b	Fig. 7 from Crawford et al., 2014
posterior lateral line has fewer parts of type posterior lateral line neuromast, abnormal	AB + MO1-mmp25b	Fig. 6 from Crawford et al., 2014
posterior lateral line development decreased process quality, abnormal	AB + MO1-mmp25b	Fig. 6 from Crawford et al., 2014
sensory perception of touch decreased process quality, abnormal	AB + MO1-mmp25b	Fig. 5 from Crawford et al., 2014
trigeminal ganglion axon misrouted, abnormal	rw0Tg + MO1-mmp25b	Fig. 7 from Crawford et al., 2014
trigeminal nerve morphogenesis decreased process quality, abnormal	rw0Tg + MO1-mmp25b	Fig. 7 from Crawford et al., 2014
trigeminal sensory neuron extracellular matrix disassembly decreased occurrence, abnormal	AB + MO1-mmp25b	Fig. 8 from Crawford et al., 2014
trigeminal sensory neuron sensory neuron axon guidance decreased process quality, abnormal	rw0Tg + MO1-mmp25b	Fig. 7 from Crawford et al., 2014

Phenotype of all Fish created by or utilizing MO1-mmp25b

Phenotype	Fish	Conditions	Figures
posterior lateral line has fewer parts of type posterior lateral line neuromast, abnormal	AB + MO1-mmp25b	standard conditions	Fig. 6 from Crawford et al., 2014
trigeminal sensory neuron extracellular matrix disassembly decreased occurrence, abnormal	AB + MO1-mmp25b	standard conditions	Fig. 8 from Crawford et al., 2014
posterior lateral line development decreased process quality, abnormal	AB + MO1-mmp25b	standard conditions	Fig. 6 from Crawford et al., 2014
sensory perception of touch decreased process quality, abnormal	AB + MO1-mmp25b	standard conditions	Fig. 5 from Crawford et al., 2014
posterior lateral line development decreased process quality, abnormal	AB + MO1-mmp25b + MO2-mmp25b	standard conditions	Fig. 6 from Crawford et al., 2014
posterior lateral line has fewer parts of type posterior lateral line neuromast, abnormal	AB + MO1-mmp25b + MO2-mmp25b	standard conditions	Fig. 6 from Crawford et al., 2014
metallopeptidase activity disrupted, abnormal	WT + MO1-mmp25b + MO2-mmp25b	standard conditions	Fig. 9 from Keow et al., 2011
trigeminal ganglion axon misrouted, abnormal	rw0Tg + MO1-mmp25b	standard conditions	Fig. 7 from Crawford et al., 2014
trigeminal sensory neuron sensory neuron axon guidance decreased process quality, abnormal	rw0Tg + MO1-mmp25b	standard conditions	Fig. 7 from Crawford et al., 2014
cranial nerve V malformed, abnormal	rw0Tg + MO1-mmp25b	standard conditions	Fig. 7 from Crawford et al., 2014
trigeminal nerve morphogenesis decreased process quality, abnormal	rw0Tg + MO1-mmp25b	standard conditions	Fig. 7 from Crawford et al., 2014

Citations