Morpholino
MO1-grk5l
- ID
- ZDB-MRPHLNO-110706-1
- Name
- MO1-grk5l
- Previous Names
-
- GRK5 MO (1)
- Target
- Sequence
-
5' - ATCCAAAGAATAGATACAGCTCCTG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO. Targets the 5'UTR.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-grk5l
No data available
Phenotype
Phenotype resulting from MO1-grk5l
1 - 5 of 18 Show all
Phenotype of all Fish created by or utilizing MO1-grk5l
1 - 5 of 20 Show all
Citations
- Lessel, D., Muhammad, T., Casar Tena, T., Moepps, B., Burkhalter, M.D., Hitz, M.P., Toka, O., Rentzsch, A., Schubert, S., Schalinski, A., Bauer, U.M., Kubisch, C., Ware, S.M., Philipp, M. (2016) The analysis of heterotaxy patients reveals new loss-of-function variants of GRK5. Scientific Reports. 6:33231
- Burkhalter, M.D., Fralish, G.B., Premont, R.T., Caron, M.G., and Philipp, M. (2013) Grk5l Controls Heart Development by Limiting mTOR Signaling during Symmetry Breaking. Cell Reports. 4(4):625-632
- Soderblom, E.J., Philipp, M., Thompson, J.W., Caron, M.G., and Moseley, M.A. (2011) Quantitative label-free phosphoproteomics strategy for multifaceted experimental designs. Analytical chemistry. 83(10):3758-3764
1 - 3 of 3
Show