Morpholino
MO1-max
- ID
- ZDB-MRPHLNO-110607-1
- Name
- MO1-max
- Previous Names
- None
- Target
- Sequence
-
5' - ATATCATCGTTGTCGCTCATTCTTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-max
No data available
Phenotype
Phenotype resulting from MO1-max
1 - 5 of 6 Show all
Phenotype of all Fish created by or utilizing MO1-max
1 - 5 of 7 Show all
Citations
- Sun, Y., Tseng, W.C., Fan, X., Ball, R., and Dougan, S.T. (2014) Extraembryonic signals under the control of MGA, Max, and Smad4 are required for dorsoventral patterning. Developmental Cell. 28(3):322-334
- Chen, Y.Y., Harris, M.P., Levesque, M.P., Nüsslein-Volhard, C., and Sonawane, M. (2012) Heterogeneity across the dorso-ventral axis in zebrafish EVL is regulated by a novel module consisting of sox, snail1a and max genes. Mechanisms of Development. 129(1-4):13-23
- Tijssen, M.R., Cvejic, A., Joshi, A., Hannah, R.L., Ferreira, R., Forrai, A., Bellissimo, D.C., Oram, S.H., Smethurst, P.A., Wilson, N.K., Wang, X., Ottersbach, K., Stemple, D.L., Green, A.R., Ouwehand, W.H., and Göttgens, B. (2011) Genome-wide Analysis of Simultaneous GATA1/2, RUNX1, FLI1, and SCL Binding in Megakaryocytes Identifies Hematopoietic Regulators. Developmental Cell. 20(5):597-609
1 - 3 of 3
Show