Morpholino

MO3-flt1

ID

ZDB-MRPHLNO-110531-3

Name

MO3-flt1

Previous Names

None

Target

flt1 (1)

Sequence

5' - ATATCGAACATTCTCTTGGTCTTGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-flt1

Expressed Gene	Anatomy	Figures
dll4	dorsal aorta intersegmental vessel whole organism	Fig. 4 from Krueger et al., 2011
flt4	dorsal aorta posterior cardinal vein	Fig. 4 from Krueger et al., 2011
kdrl	dorsal aorta intersegmental vessel endothelial tip cell	Fig. 4 from Krueger et al., 2011
nrarpa	whole organism	Fig. 4 from Krueger et al., 2011
nrarpb	whole organism	Fig. 4 from Krueger et al., 2011

Phenotype

Phenotype resulting from MO3-flt1

Phenotype	Fish	Figures
blood vessel endothelial cell increased amount, abnormal	y1Tg + MO3-flt1	Fig. 3 from Krueger et al., 2011
blood vessel morphogenesis disrupted, abnormal	y1Tg + MO3-flt1	Fig. 2 , Fig. 3 from Krueger et al., 2011
intersegmental artery increased branchiness, abnormal	y1Tg + MO3-flt1	Fig. 6 from Bower et al., 2017
intersegmental artery blood vessel endothelial cell increased area, abnormal	WT + MO3-flt1	Fig. 8 from Klems et al., 2020
intersegmental vein blood vessel endothelial cell increased amount, abnormal	ubs1Tg + MO3-flt1	Fig. 2 from Page et al., 2019
intersegmental vessel disorganized, abnormal	y1Tg + MO3-flt1	Fig. 2 , Fig. 3 from Krueger et al., 2011
intersegmental vessel endothelial tip cell increased width, abnormal	s896Tg + MO3-flt1	Fig. 4 from Krueger et al., 2011
intersegmental vessel vascular sprouts increased amount, abnormal	hu5333Tg; hu7135Tg + MO3-flt1	Fig. 4 from Wild et al., 2017
spinal cord has fewer parts of type CNS neuron (sensu Vertebrata), abnormal	knu3Tg; s896Tg + MO3-flt1	Fig. 5 from Krueger et al., 2011
sprouting angiogenesis disrupted, abnormal	y1Tg + MO3-flt1	Fig. 2 , Fig. 3 from Krueger et al., 2011
vascular sprouts has extra parts of type endothelial tip cell, abnormal	y1Tg + MO3-flt1	Fig. 3 from Krueger et al., 2011

Phenotype of all Fish created by or utilizing MO3-flt1

Phenotype	Fish	Conditions	Figures
intersegmental artery blood vessel endothelial cell increased area, abnormal	WT + MO3-flt1	standard conditions	Fig. 8 from Klems et al., 2020
intersegmental vessel endothelial tip cell increased width, abnormal	s896Tg + MO3-flt1	standard conditions	Fig. 4 from Krueger et al., 2011
intersegmental vein blood vessel endothelial cell increased amount, abnormal	ubs1Tg + MO3-flt1	standard conditions	Fig. 2 from Page et al., 2019
blood vessel morphogenesis disrupted, abnormal	y1Tg + MO3-flt1	standard conditions	Fig. 2 , Fig. 3 from Krueger et al., 2011
blood vessel endothelial cell increased amount, abnormal	y1Tg + MO3-flt1	standard conditions	Fig. 3 from Krueger et al., 2011
intersegmental artery increased branchiness, abnormal	y1Tg + MO3-flt1	standard conditions	Fig. 6 from Bower et al., 2017
vascular sprouts has extra parts of type endothelial tip cell, abnormal	y1Tg + MO3-flt1	standard conditions	Fig. 3 from Krueger et al., 2011
sprouting angiogenesis disrupted, abnormal	y1Tg + MO3-flt1	standard conditions	Fig. 2 , Fig. 3 from Krueger et al., 2011
intersegmental vessel disorganized, abnormal	y1Tg + MO3-flt1	standard conditions	Fig. 2 , Fig. 3 from Krueger et al., 2011
intersegmental vessel vascular sprouts increased amount, abnormal	hu5333Tg; hu7135Tg + MO3-flt1	standard conditions	Fig. 4 from Wild et al., 2017
spinal cord has fewer parts of type CNS neuron (sensu Vertebrata), abnormal	knu3Tg; s896Tg + MO3-flt1	standard conditions	Fig. 5 from Krueger et al., 2011
intersegmental artery increased diameter, abnormal	s916Tg + MO3-flt1	standard conditions	Fig. 1 from Klems et al., 2020
intersegmental artery increased branchiness, exacerbated	dll4^uq10bh/+; y1Tg + MO3-flt1	standard conditions	Fig. 6 from Bower et al., 2017
intersegmental artery increased diameter, abnormal	flt4^mu407/mu407; y1Tg + MO3-flt1	standard conditions	Fig. 3 from Klems et al., 2020
intersegmental artery branched, abnormal	hu4624Tg; s916Tg + MO3-flt1	standard conditions	Fig. 5 from Krueger et al., 2011
intersegmental artery branchiness, ameliorated	vegfc^{hu5055/hu5055}; y1Tg + MO3-flt1	standard conditions	Fig. 6 from Bower et al., 2017
intersegmental artery decreased diameter, abnormal	ka613Tg; s916Tg + MO3-flt1	standard conditions	Fig. 2 from Klems et al., 2020
intersegmental artery branchiness, ameliorated	vegfc^{hu5055/hu5055}; vegfd^uq9bh/uq9bh; y1Tg + MO3-flt1	standard conditions	Fig. 6 from Bower et al., 2017

Citations