Morpholino
MO2-adrb1
- ID
- ZDB-MRPHLNO-110525-2
- Name
- MO2-adrb1
- Previous Names
-
- beta1AR MO (1)
- Target
- Sequence
-
5' - ACGGTAGCCCGTCTCCCATGATTTG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-adrb1
No data available
Phenotype
Phenotype resulting from MO2-adrb1
| Phenotype | Fish | Figures |
|---|---|---|
| heart contraction decreased rate, abnormal | WT + MO2-adrb1 |
text only
from Steele et al., 2011 |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO2-adrb1
1 - 4 of 4
Citations
- Li, W., Shenkar, R., Detter, M.R., Moore, T., Benavides, C.R., Lightle, R., Girard, R., Hobson, N., Cao, Y., Li, Y., Griffin, E., Gallione, C., Zabramski, J.M., Ginsberg, M.H., Marchuk, D.A., Awad, I.A. (2020) Propranolol inhibits cavernous vascular malformations by β1 adrenergic receptor antagonism. The Journal of Clinical Investigation. 131(3)
- Miller, S., Pollack, J., Bradshaw, J., Kumai, Y., Perry, S.F. (2014) Cardiac responses to hypercapnia in larval zebrafish (Danio rerio): The links between CO2 chemoreception, catecholamines and carbonic anhydrase. The Journal of experimental biology. 217(Pt 19):3569-78
- Kumai, Y., Ward, M., and Perry, S.F. (2012) β-Adrenergic regulation of Na+ uptake by larval zebrafish Danio rerio in acidic and ion-poor environments. American journal of physiology. Regulatory, integrative and comparative physiology. 303(10):R1031-1041
- Steele, S.L., Yang, X., Debiais-Thibaud, M., Schwerte, T., Pelster, B., Ekker, M., Tiberi, M., Perry, S.F. (2011) In vivo and in vitro assessment of cardiac {beta}-adrenergic receptors in larval zebrafish (Danio rerio). The Journal of experimental biology. 214(9):1445-1457
1 - 4 of 4
Show