Morpholino

MO2-rab18b

ID
ZDB-MRPHLNO-110516-4
Name
MO2-rab18b
Previous Names
  • rab18bMO2 (1)
Target
Sequence
5' - TTGCTGTTGCTGCGCTGGAACTTCC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO, targets the 5'UTR.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-rab18b
No data available
Phenotype
Phenotype resulting from MO2-rab18b
Phenotype Fish Figures
embryo development delayed, abnormal WT + MO2-rab18b Fig. S8,  Fig. S9 from Bem et al., 2011
eye decreased size, abnormal WT + MO2-rab18b Fig. S7,  Fig. S8,  Fig. S9 from Bem et al., 2011
eye deformed, abnormal WT + MO2-rab18b Fig. S7 from Bem et al., 2011
head decreased size, abnormal WT + MO2-rab18b Fig. S8 from Bem et al., 2011
iridophore absent, abnormal WT + MO2-rab18b Fig. S7 from Bem et al., 2011
iridophore decreased amount, abnormal WT + MO2-rab18b Fig. S7 from Bem et al., 2011
iridophore low saturation, abnormal WT + MO2-rab18b Fig. S7 from Bem et al., 2011
lens non-functional, abnormal WT + MO2-rab18b Fig. S9 from Bem et al., 2011
mandibular arch skeleton immature, abnormal WT + MO2-rab18b Fig. S8 from Bem et al., 2011
mandibular arch skeleton malformed, abnormal WT + MO2-rab18b Fig. S9 from Bem et al., 2011
optic fissure closure incomplete, abnormal WT + MO2-rab18b Fig. S7 from Bem et al., 2011
optic fissure open, abnormal WT + MO2-rab18b Fig. S9 from Bem et al., 2011
pericardium edematous, abnormal WT + MO2-rab18b Fig. S8,  Fig. S9 from Bem et al., 2011
retina layer formation disrupted, abnormal WT + MO2-rab18b Fig. S9 from Bem et al., 2011
whole organism decreased size, abnormal WT + MO2-rab18b Fig. S8 from Bem et al., 2011
Phenotype of all Fish created by or utilizing MO2-rab18b
Phenotype Fish Conditions Figures
eye deformed, abnormal WT + MO2-rab18b standard conditions Fig. S7 from Bem et al., 2011
eye decreased size, abnormal WT + MO2-rab18b standard conditions Fig. S7,  Fig. S8,  Fig. S9 from Bem et al., 2011
iridophore low saturation, abnormal WT + MO2-rab18b standard conditions Fig. S7 from Bem et al., 2011
iridophore decreased amount, abnormal WT + MO2-rab18b standard conditions Fig. S7 from Bem et al., 2011
pericardium edematous, abnormal WT + MO2-rab18b standard conditions Fig. S8,  Fig. S9 from Bem et al., 2011
embryo development delayed, abnormal WT + MO2-rab18b standard conditions Fig. S8,  Fig. S9 from Bem et al., 2011
head decreased size, abnormal WT + MO2-rab18b standard conditions Fig. S8 from Bem et al., 2011
optic fissure open, abnormal WT + MO2-rab18b standard conditions Fig. S9 from Bem et al., 2011
iridophore absent, abnormal WT + MO2-rab18b standard conditions Fig. S7 from Bem et al., 2011
mandibular arch skeleton malformed, abnormal WT + MO2-rab18b standard conditions Fig. S9 from Bem et al., 2011
retina layer formation disrupted, abnormal WT + MO2-rab18b standard conditions Fig. S9 from Bem et al., 2011
optic fissure closure incomplete, abnormal WT + MO2-rab18b standard conditions Fig. S7 from Bem et al., 2011
whole organism decreased size, abnormal WT + MO2-rab18b standard conditions Fig. S8 from Bem et al., 2011
mandibular arch skeleton immature, abnormal WT + MO2-rab18b standard conditions Fig. S8 from Bem et al., 2011
lens non-functional, abnormal WT + MO2-rab18b standard conditions Fig. S9 from Bem et al., 2011
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.