Morpholino
MO1-ptgs2b
- ID
- ZDB-MRPHLNO-110427-5
- Name
- MO1-ptgs2b
- Previous Names
- None
- Target
- Sequence
-
5' - AGGCTTACCTCCTGTGCAAACCACG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ptgs2b
No data available
Phenotype
Phenotype resulting from MO1-ptgs2b
No data available
Phenotype of all Fish created by or utilizing MO1-ptgs2b
1 - 5 of 11 Show all
Citations
- Li, W., Jin, D., Zhong, T.P. (2019) Photoreceptor cell development requires prostaglandin signaling in the zebrafish retina. Biochemical and Biophysical Research Communications. 510(2):230-235
- Esain, V., Kwan, W., Carroll, K.J., Cortes, M., Liu, S.Y., Frechette, G.M., Sheward, L.M., Nissim, S., Goessling, W., North, T.E. (2015) Cannabinoid Receptor-2 Regulates Embryonic Hematopoietic Stem Cell Development via PGE2 and P-selectin Activity. Stem cells (Dayton, Ohio). 33(8):2596-612
- Teraoka, H., Okuno, Y., Nijoukubo, D., Yamakoshi, A., Peterson, R.E., Stegeman, J.J., Kitazawa, T., Hiraga, T., Kubota, A. (2014) Involvement of COX2-thromboxane pathway in TCDD-induced precardiac edema in developing zebrafish. Aquatic toxicology (Amsterdam, Netherlands). 154C:19-26
- Yeh, J.R., Munson, K.M., Elagib, K.E., Goldfarb, A.N., Sweetser, D.A., and Peterson, R.T. (2009) Discovering chemical modifiers of oncogene-regulated hematopoietic differentiation. Nature Chemical Biology. 5(4):236-243
1 - 4 of 4
Show