Morpholino

MO3-ctcf

ID
ZDB-MRPHLNO-110420-1
Name
MO3-ctcf
Previous Names
  • ctcfATG (1)
Target
Sequence
5' - CGGCCTCAGTCGGTCCCCCTTCCATG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-ctcf
Expressed Gene Anatomy Figures
bbc3 Fig. 6 from Carmona-Aldana et al., 2018
ctcf Fig. 3 from Carmona-Aldana et al., 2018
myf5 Fig. 6 from Delgado-Olguin et al., 2011
myf6 Fig. 6 from Delgado-Olguin et al., 2011
myod1 Fig. 6 from Delgado-Olguin et al., 2011
myog Fig. 5,  Fig. 6 from Delgado-Olguin et al., 2011
tp53 Fig. 6 from Carmona-Aldana et al., 2018
Phenotype
Phenotype resulting from MO3-ctcf
Phenotype Fish Figures
anatomical structure myog expression decreased amount, abnormal WT + MO3-ctcf Fig. 5 from Delgado-Olguin et al., 2011
brain segmentation decreased process quality, abnormal WT + MO3-ctcf Fig. 4 with image,  Fig. 5 with image from Carmona-Aldana et al., 2018
dorsal oblique extraocular muscle myog expression absent, abnormal WT + MO3-ctcf Fig. 5 from Delgado-Olguin et al., 2011
eye hypoplastic, abnormal WT + MO3-ctcf Fig. 4 with image,  Fig. 5 with image from Carmona-Aldana et al., 2018
forebrain morphology, abnormal WT + MO3-ctcf Fig. 4 with image,  Fig. 5 with image from Carmona-Aldana et al., 2018
head shape, abnormal WT + MO3-ctcf Fig. 5 with image from Carmona-Aldana et al., 2018
hindbrain morphology, abnormal WT + MO3-ctcf Fig. 4 with image,  Fig. 5 with image from Carmona-Aldana et al., 2018
hypaxial myotome region myog expression absent, abnormal WT + MO3-ctcf Fig. 5 from Delgado-Olguin et al., 2011
lateral rectus myog expression absent, abnormal WT + MO3-ctcf Fig. 5 from Delgado-Olguin et al., 2011
levator arcus palatini myog expression absent, abnormal WT + MO3-ctcf Fig. 5 from Delgado-Olguin et al., 2011
midbrain morphology, abnormal WT + MO3-ctcf Fig. 4 with image,  Fig. 5 with image from Carmona-Aldana et al., 2018
muscle myog expression decreased amount, abnormal WT + MO3-ctcf Fig. 6 from Delgado-Olguin et al., 2011
muscle cell decreased amount, abnormal WT + MO3-ctcf Fig. 5 from Delgado-Olguin et al., 2011
notochord morphology, abnormal WT + MO3-ctcf Fig. 4 with image,  Fig. 5 with image from Carmona-Aldana et al., 2018
pectoral fin musculature myog expression decreased amount, abnormal WT + MO3-ctcf Fig. 5 from Delgado-Olguin et al., 2011
post-vent region decreased size, abnormal WT + MO3-ctcf Fig. 4 with image,  Fig. 5 with image from Carmona-Aldana et al., 2018
post-vent region increased curvature, abnormal WT + MO3-ctcf Fig. 5 from Delgado-Olguin et al., 2011
post-vent region shape, abnormal WT + MO3-ctcf Fig. 5 with image from Carmona-Aldana et al., 2018
skeletal muscle tissue development disrupted, abnormal WT + MO3-ctcf Fig. 5,  Fig. 6 from Delgado-Olguin et al., 2011
somite disorganized, abnormal WT + MO3-ctcf Fig. 5 from Delgado-Olguin et al., 2011
somite morphology, abnormal WT + MO3-ctcf Fig. 4 with image,  Fig. 5 with image from Carmona-Aldana et al., 2018
Fig. 6 from Delgado-Olguin et al., 2011
somite shape, abnormal WT + MO3-ctcf Fig. 5 from Delgado-Olguin et al., 2011
somitogenesis disrupted, abnormal WT + MO3-ctcf Fig. 5 from Delgado-Olguin et al., 2011
ventral mandibular arch myog expression absent, abnormal WT + MO3-ctcf Fig. 5 from Delgado-Olguin et al., 2011
ventral transverse myog expression absent, abnormal WT + MO3-ctcf Fig. 5 from Delgado-Olguin et al., 2011
whole organism myod1 expression decreased amount, abnormal WT + MO3-ctcf Fig. 6 from Delgado-Olguin et al., 2011
whole organism ctcf expression decreased amount, abnormal WT + MO3-ctcf Fig. 3 from Carmona-Aldana et al., 2018
whole organism myog expression decreased amount, abnormal WT + MO3-ctcf Fig. 6 from Delgado-Olguin et al., 2011
whole organism decreased length, abnormal WT + MO3-ctcf Fig. 4 with image,  Fig. 5 with image from Carmona-Aldana et al., 2018
Fig. 6 from Delgado-Olguin et al., 2011
whole organism myf5 expression increased amount, abnormal WT + MO3-ctcf Fig. 6 from Delgado-Olguin et al., 2011
whole organism tp53 expression increased amount, abnormal WT + MO3-ctcf Fig. 6 from Carmona-Aldana et al., 2018
whole organism bbc3 expression increased amount, abnormal WT + MO3-ctcf Fig. 6 from Carmona-Aldana et al., 2018
whole organism morphology, abnormal WT + MO3-ctcf Fig. 5 with image from Carmona-Aldana et al., 2018
Phenotype of all Fish created by or utilizing MO3-ctcf
Phenotype Fish Conditions Figures
notochord morphology, abnormal WT + MO3-ctcf standard conditions Fig. 4 with image,  Fig. 5 with image from Carmona-Aldana et al., 2018
somite morphology, abnormal WT + MO3-ctcf standard conditions Fig. 4 with image,  Fig. 5 with image from Carmona-Aldana et al., 2018
Fig. 6 from Delgado-Olguin et al., 2011
whole organism myf5 expression increased amount, abnormal WT + MO3-ctcf standard conditions Fig. 6 from Delgado-Olguin et al., 2011
whole organism bbc3 expression increased amount, abnormal WT + MO3-ctcf standard conditions Fig. 6 from Carmona-Aldana et al., 2018
dorsal oblique extraocular muscle myog expression absent, abnormal WT + MO3-ctcf standard conditions Fig. 5 from Delgado-Olguin et al., 2011
whole organism myod1 expression decreased amount, abnormal WT + MO3-ctcf standard conditions Fig. 6 from Delgado-Olguin et al., 2011
somite shape, abnormal WT + MO3-ctcf standard conditions Fig. 5 from Delgado-Olguin et al., 2011
muscle cell decreased amount, abnormal WT + MO3-ctcf standard conditions Fig. 5 from Delgado-Olguin et al., 2011
levator arcus palatini myog expression absent, abnormal WT + MO3-ctcf standard conditions Fig. 5 from Delgado-Olguin et al., 2011
post-vent region shape, abnormal WT + MO3-ctcf standard conditions Fig. 5 with image from Carmona-Aldana et al., 2018
somite disorganized, abnormal WT + MO3-ctcf standard conditions Fig. 5 from Delgado-Olguin et al., 2011
muscle myog expression decreased amount, abnormal WT + MO3-ctcf standard conditions Fig. 6 from Delgado-Olguin et al., 2011
whole organism ctcf expression decreased amount, abnormal WT + MO3-ctcf standard conditions Fig. 3 from Carmona-Aldana et al., 2018
skeletal muscle tissue development disrupted, abnormal WT + MO3-ctcf standard conditions Fig. 5,  Fig. 6 from Delgado-Olguin et al., 2011
whole organism morphology, abnormal WT + MO3-ctcf standard conditions Fig. 5 with image from Carmona-Aldana et al., 2018
hypaxial myotome region myog expression absent, abnormal WT + MO3-ctcf standard conditions Fig. 5 from Delgado-Olguin et al., 2011
post-vent region increased curvature, abnormal WT + MO3-ctcf standard conditions Fig. 5 from Delgado-Olguin et al., 2011
whole organism decreased length, abnormal WT + MO3-ctcf standard conditions Fig. 4 with image,  Fig. 5 with image from Carmona-Aldana et al., 2018
Fig. 6 from Delgado-Olguin et al., 2011
brain segmentation decreased process quality, abnormal WT + MO3-ctcf standard conditions Fig. 4 with image,  Fig. 5 with image from Carmona-Aldana et al., 2018
hindbrain morphology, abnormal WT + MO3-ctcf standard conditions Fig. 4 with image,  Fig. 5 with image from Carmona-Aldana et al., 2018
head shape, abnormal WT + MO3-ctcf standard conditions Fig. 5 with image from Carmona-Aldana et al., 2018
pectoral fin musculature myog expression decreased amount, abnormal WT + MO3-ctcf standard conditions Fig. 5 from Delgado-Olguin et al., 2011
post-vent region decreased size, abnormal WT + MO3-ctcf standard conditions Fig. 4 with image,  Fig. 5 with image from Carmona-Aldana et al., 2018
whole organism myog expression decreased amount, abnormal WT + MO3-ctcf standard conditions Fig. 6 from Delgado-Olguin et al., 2011
somitogenesis disrupted, abnormal WT + MO3-ctcf standard conditions Fig. 5 from Delgado-Olguin et al., 2011
anatomical structure myog expression decreased amount, abnormal WT + MO3-ctcf standard conditions Fig. 5 from Delgado-Olguin et al., 2011
forebrain morphology, abnormal WT + MO3-ctcf standard conditions Fig. 4 with image,  Fig. 5 with image from Carmona-Aldana et al., 2018
ventral mandibular arch myog expression absent, abnormal WT + MO3-ctcf standard conditions Fig. 5 from Delgado-Olguin et al., 2011
ventral transverse myog expression absent, abnormal WT + MO3-ctcf standard conditions Fig. 5 from Delgado-Olguin et al., 2011
whole organism tp53 expression increased amount, abnormal WT + MO3-ctcf standard conditions Fig. 6 from Carmona-Aldana et al., 2018
eye hypoplastic, abnormal WT + MO3-ctcf standard conditions Fig. 4 with image,  Fig. 5 with image from Carmona-Aldana et al., 2018
lateral rectus myog expression absent, abnormal WT + MO3-ctcf standard conditions Fig. 5 from Delgado-Olguin et al., 2011
midbrain morphology, abnormal WT + MO3-ctcf standard conditions Fig. 4 with image,  Fig. 5 with image from Carmona-Aldana et al., 2018
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.