Morpholino
MO1-hipk2
- ID
- ZDB-MRPHLNO-110331-3
- Name
- MO1-hipk2
- Previous Names
-
- HIPK2a MO (1)
- Target
- Sequence
-
5' - TGACAAGATCAGCACCTTACCTATA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-hipk2
No data available
Phenotype
Phenotype resulting from MO1-hipk2
1 - 5 of 6 Show all
Phenotype of all Fish created by or utilizing MO1-hipk2
1 - 5 of 7 Show all
Citations
- Klingbeil, K., Nguyen, T., Fahrner, A., Guthmann, C., Wang, H., Schoels, M., Lilienkamp, M., Franz, H., Eckert, P., Walz, G., Yakulov, T.A. (2021) Corpuscles of Stannius development requires FGF signaling. Developmental Biology. 481:160-171
- Bitomsky, N., Conrad, E., Moritz, C., Polonio-Vallon, T., Sombroek, D., Schultheiss, K., Glas, C., Greiner, V., Herbel, C., Mantovani, F., Del Sal, G., Peri, F., and Hofmann, T.G. (2013) Autophosphorylation and Pin1 binding coordinate DNA damage-induced HIPK2 activation and cell death. Proceedings of the National Academy of Sciences of the United States of America. 110(45):E4203-4212
- Liang, H., Fekete, D.M., and Andrisani, O. (2011) CtBP2 Downregulation during Neural Crest Specification Induces Expression of Mitf and REST, Resulting in Melanocyte Differentiation and Sympathoadrenal Lineage Suppression. Molecular and cellular biology. 31(5):955-970
1 - 3 of 3
Show