Morpholino

MO1-wnt9a

ID
ZDB-MRPHLNO-110321-2
Name
MO1-wnt9a
Previous Names
  • wnt9a MO (1)
Target
Sequence
5' - CCAGGAGAAGGTGTCCATCCAGCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-wnt9a
Phenotype
Phenotype resulting from MO1-wnt9a
Phenotype Fish Figures
cranial neural crest cell lateralized, abnormal TU + MO1-wnt9a Fig. 7 with image from Curtin et al., 2011
cranial neural crest cell dorsal region mislocalised laterally, abnormal zf220Tg + MO1-wnt9a (TU) Fig. 5 with image from Curtin et al., 2011
embryonic neurocranium morphogenesis decreased process quality, abnormal nu12Tg + MO1-wnt9a Fig. 2 with image from Dougherty et al., 2013
ethmoid cartilage aplastic, abnormal TU + MO1-wnt9a Fig. 3 with imageFig. 5 with imageFig. 7 with image from Curtin et al., 2011
ethmoid cartilage decreased length, abnormal vu234Tg + MO1-wnt9a Fig. 2 with image from Dougherty et al., 2013
ethmoid cartilage has fewer parts of type chondrocyte, abnormal nu12Tg + MO1-wnt9a Fig. 2 with image from Dougherty et al., 2013
ethmoid cartilage chondrocyte disorganized, abnormal nu12Tg + MO1-wnt9a Fig. 2 with image from Dougherty et al., 2013
ethmoid cartilage chondrocyte shape, abnormal nu12Tg + MO1-wnt9a Fig. 2 with image from Dougherty et al., 2013
ethmoid cartilage chondrocyte proliferation decreased occurrence, abnormal vu234Tg + MO1-wnt9a Fig. 2 with image from Dougherty et al., 2013
head hypoplastic, abnormal TU + MO1-wnt9a Fig. 3 with image from Curtin et al., 2011
neural crest cell development disrupted, abnormal zf220Tg + MO1-wnt9a (TU) Fig. 5 with imageFig. 7 with image from Curtin et al., 2011
neural crest cell migration disrupted, abnormal zf220Tg + MO1-wnt9a (TU) Fig. 5 with image from Curtin et al., 2011
neurocranial trabecula chondrocyte circular, abnormal TU + MO1-wnt9a Fig. 3 with image from Curtin et al., 2011
neurocranial trabecula chondrocyte disorganized, abnormal TU + MO1-wnt9a Fig. 3 with image from Curtin et al., 2011
neurocranial trabecula proximal region decreased length, abnormal zf220Tg + MO1-wnt9a (TU) Fig. 3 with imageFig. 5 with image from Curtin et al., 2011
neurocranial trabecula proximal region truncated, abnormal TU + MO1-wnt9a Fig. 7 with image from Curtin et al., 2011
parachordal cartilage postero-lateral region aplastic, abnormal TU + MO1-wnt9a Fig. 3 with image from Curtin et al., 2011
pharyngeal arch 1 mesenchyme nkx3-2 expression decreased amount, abnormal WT + MO1-wnt9a Fig. 6 with image from Kamel et al., 2013
pharyngeal arch 3-7 morphology, abnormal TU + MO1-wnt9a Fig. 7 with image from Curtin et al., 2011
stomodeum shape, abnormal TU + MO1-wnt9a Fig. 7 with image from Curtin et al., 2011
trabecula communis aplastic, abnormal zf220Tg + MO1-wnt9a (TU) Fig. 5 with image from Curtin et al., 2011
ventral mandibular arch aplastic, abnormal TU + MO1-wnt9a Fig. 3 with image from Curtin et al., 2011
whole organism nkx3-2 expression decreased amount, abnormal WT + MO1-wnt9a Fig. 6 with image from Kamel et al., 2013
Phenotype of all Fish created by or utilizing MO1-wnt9a
Phenotype Fish Conditions Figures
neural crest cell development disrupted, abnormal TU + MO1-wnt9a standard conditions Fig. 7 with image from Curtin et al., 2011
head hypoplastic, abnormal TU + MO1-wnt9a standard conditions Fig. 3 with image from Curtin et al., 2011
pharyngeal arch 3-7 morphology, abnormal TU + MO1-wnt9a standard conditions Fig. 7 with image from Curtin et al., 2011
neurocranial trabecula proximal region truncated, abnormal TU + MO1-wnt9a standard conditions Fig. 7 with image from Curtin et al., 2011
parachordal cartilage postero-lateral region aplastic, abnormal TU + MO1-wnt9a standard conditions Fig. 3 with image from Curtin et al., 2011
ethmoid cartilage aplastic, abnormal TU + MO1-wnt9a standard conditions Fig. 3 with imageFig. 7 with image from Curtin et al., 2011
ventral mandibular arch aplastic, abnormal TU + MO1-wnt9a standard conditions Fig. 3 with image from Curtin et al., 2011
stomodeum shape, abnormal TU + MO1-wnt9a standard conditions Fig. 7 with image from Curtin et al., 2011
neurocranial trabecula proximal region decreased length, abnormal TU + MO1-wnt9a standard conditions Fig. 3 with image from Curtin et al., 2011
neurocranial trabecula chondrocyte disorganized, abnormal TU + MO1-wnt9a standard conditions Fig. 3 with image from Curtin et al., 2011
cranial neural crest cell lateralized, abnormal TU + MO1-wnt9a standard conditions Fig. 7 with image from Curtin et al., 2011
neurocranial trabecula chondrocyte circular, abnormal TU + MO1-wnt9a standard conditions Fig. 3 with image from Curtin et al., 2011
whole organism nkx3-2 expression decreased amount, abnormal WT + MO1-wnt9a standard conditions Fig. 6 with image from Kamel et al., 2013
pharyngeal arch 1 mesenchyme nkx3-2 expression decreased amount, abnormal WT + MO1-wnt9a standard conditions Fig. 6 with image from Kamel et al., 2013
embryonic neurocranium morphogenesis decreased process quality, abnormal nu12Tg + MO1-wnt9a standard conditions Fig. 2 with image from Dougherty et al., 2013
ethmoid cartilage chondrocyte shape, abnormal nu12Tg + MO1-wnt9a standard conditions Fig. 2 with image from Dougherty et al., 2013
ethmoid cartilage has fewer parts of type chondrocyte, abnormal nu12Tg + MO1-wnt9a standard conditions Fig. 2 with image from Dougherty et al., 2013
ethmoid cartilage chondrocyte disorganized, abnormal nu12Tg + MO1-wnt9a standard conditions Fig. 2 with image from Dougherty et al., 2013
ethmoid cartilage decreased length, abnormal nu12Tg + MO1-wnt9a standard conditions Fig. 2 with image from Dougherty et al., 2013
ethmoid cartilage decreased length, abnormal vu234Tg + MO1-wnt9a standard conditions Fig. 2 with image from Dougherty et al., 2013
embryonic neurocranium morphogenesis decreased process quality, abnormal vu234Tg + MO1-wnt9a standard conditions Fig. 2 with image from Dougherty et al., 2013
ethmoid cartilage chondrocyte proliferation decreased occurrence, abnormal vu234Tg + MO1-wnt9a standard conditions Fig. 2 with image from Dougherty et al., 2013
ethmoid cartilage aplastic, abnormal zf220Tg + MO1-wnt9a (TU) standard conditions Fig. 5 with image from Curtin et al., 2011
trabecula communis aplastic, abnormal zf220Tg + MO1-wnt9a (TU) standard conditions Fig. 5 with image from Curtin et al., 2011
cranial neural crest cell dorsal region mislocalised laterally, abnormal zf220Tg + MO1-wnt9a (TU) standard conditions Fig. 5 with image from Curtin et al., 2011
neurocranial trabecula proximal region decreased length, abnormal zf220Tg + MO1-wnt9a (TU) standard conditions Fig. 5 with image from Curtin et al., 2011
neural crest cell migration disrupted, abnormal zf220Tg + MO1-wnt9a (TU) standard conditions Fig. 5 with image from Curtin et al., 2011
neural crest cell development disrupted, abnormal zf220Tg + MO1-wnt9a (TU) standard conditions Fig. 5 with image from Curtin et al., 2011
ethmoid cartilage decreased length, abnormal zf393Tg + MO1-wnt9a standard conditions Fig. 2 with image from Dougherty et al., 2013
ventral aorta myb expression decreased amount, abnormal WT + MO1-egfra + MO1-wnt9a standard conditions Fig. 4 from Grainger et al., 2019
ventral aorta myb expression decreased amount, abnormal WT + MO1-wnt9a + MO2-fzd9b standard conditions Fig. 2 from Grainger et al., 2019
ventral wall of dorsal aorta hematopoietic stem cell decreased amount, abnormal y171Tg; zf169Tg + MO1-wnt9a standard conditions Fig. 3 with image from Grainger et al., 2016
Citations