Morpholino
MO2-pik3cg
- ID
- ZDB-MRPHLNO-110317-2
- Name
- MO2-pik3cg
- Previous Names
-
- MO2-zgc:77033
- Target
- Sequence
-
5' - CATCATCACTGGCTTGCTGTTCCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-pik3cg
No data available
Phenotype
Phenotype resulting from MO2-pik3cg
No data available
Phenotype of all Fish created by or utilizing MO2-pik3cg
1 - 4 of 4
Citations
- Zhang, Y.M., Zimmer, M.A., Guardia, T., Callahan, S.J., Mondal, C., Di Martino, J., Takagi, T., Fennell, M., Garippa, R., Campbell, N.R., Bravo-Cordero, J.J., White, R.M. (2018) Distant Insulin Signaling Regulates Vertebrate Pigmentation through the Sheddase Bace2. Developmental Cell. 45(5):580-594.e7
- Li, P., Lahvic, J.L., Binder, V., Pugach, E.K., Riley, E.B., Tamplin, O.J., Panigrahy, D., Bowman, T.V., Barrett, F.G., Heffner, G.C., McKinney-Freeman, S., Schlaeger, T.M., Daley, G.Q., Zeldin, D.C., Zon, L.I. (2015) Epoxyeicosatrienoic acids enhance embryonic haematopoiesis and adult marrow engraftment. Nature. 523:468-71
- Yoo, S.K., Deng, Q., Cavnar, P.J., Wu, Y.I., Hahn, K.M., and Huttenlocher, A. (2010) Differential Regulation of Protrusion and Polarity by PI(3)K during Neutrophil Motility in Live Zebrafish. Developmental Cell. 18(2):226-236
1 - 3 of 3
Show