Morpholino
MO2-neo1a
- ID
- ZDB-MRPHLNO-110301-10
- Name
- MO2-neo1a
- Previous Names
-
- ATG-MO (1)
- Target
- Sequence
-
5' - GGCTCCCCGCTCCGCCATCACTTTA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-neo1a
No data available
Phenotype
Phenotype resulting from MO2-neo1a
1 - 5 of 50 Show all
Phenotype of all Fish created by or utilizing MO2-neo1a
1 - 5 of 52 Show all
Citations
- Brown, S., Jayachandran, P., Negesse, M., Olmo, V., Vital, E., Brewster, R. (2019) Rgma-induced Neo1 proteolysis promotes neural tube morphogenesis. The Journal of neuroscience : the official journal of the Society for Neuroscience. 39(38):7465-7484
- Gao, J., Zhang, C., Yang, B., Sun, L., Zhang, C., Westerfield, M., and Peng, G. (2012) Dcc Regulates Asymmetric Outgrowth of Forebrain Neurons in Zebrafish. PLoS One. 7(5):e36516
- Gibert, Y., Lattanzi, V.J., Zhen, A.W., Vedder, L., Brunet, F., Faasse, S.A., Babitt, J.L., Lin, H.Y., Hammerschmidt, M., and Fraenkel, P.G. (2011) BMP Signaling Modulates Hepcidin Expression in Zebrafish Embryos Independent of Hemojuvelin. PLoS One. 6(1):e14553
- Mawdsley, D.J., Cooper, H.M., Hogan, B.M., Cody, S.H., Lieschke, G.J., and Heath, J.K. (2004) The Netrin receptor Neogenin is required for neural tube formation and somitogenesis in zebrafish. Developmental Biology. 269(1):302-315
1 - 4 of 4
Show