Morpholino

MO1-tnnt3a

ID

ZDB-MRPHLNO-110228-3

Name

MO1-tnnt3a

Previous Names

None

Target

tnnt3a (1)

Sequence

5' - CTCAATGTCCTCTGTGTCTGACATG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-tnnt3a

No data available

Phenotype

Phenotype resulting from MO1-tnnt3a

Phenotype	Fish	Figures
fast muscle cell actin filament disorganized, abnormal	WT + MO1-tnnt3a	Fig. 4 from Ferrante et al., 2011
fast muscle cell actin filament distributed, abnormal	WT + MO1-tnnt3a	Fig. 6 from Ferrante et al., 2011
fast muscle cell myofibril degenerate, abnormal	WT + MO1-tnnt3a	Fig. 6 from Ferrante et al., 2011
skeletal muscle sarcomere disorganized, abnormal	WT + MO1-tnnt3a	Fig. 4 from Ferrante et al., 2011
trunk muscle refractivity, abnormal	WT + MO1-tnnt3a	Fig. 4 from Ferrante et al., 2011

Phenotype of all Fish created by or utilizing MO1-tnnt3a

Phenotype	Fish	Conditions	Figures
trunk muscle refractivity, abnormal	WT + MO1-tnnt3a	standard conditions	Fig. 4 from Ferrante et al., 2011
fast muscle cell actin filament distributed, abnormal	WT + MO1-tnnt3a	standard conditions	Fig. 6 from Ferrante et al., 2011
fast muscle cell myofibril degenerate, abnormal	WT + MO1-tnnt3a	standard conditions	Fig. 6 from Ferrante et al., 2011
fast muscle cell actin filament disorganized, abnormal	WT + MO1-tnnt3a	standard conditions	Fig. 4 from Ferrante et al., 2011
skeletal muscle sarcomere disorganized, abnormal	WT + MO1-tnnt3a	standard conditions	Fig. 4 from Ferrante et al., 2011
fast muscle cell myofibril undulate, abnormal	dul^tu45/tu45 + MO1-tnnt3a	standard conditions	Fig. 6 from Ferrante et al., 2011
fast muscle cell actin filament undistributed, abnormal	dul^tu45/tu45 + MO1-tnnt3a	standard conditions	Fig. 6 from Ferrante et al., 2011
fast muscle cell muscle thin filament tropomyosin absent, abnormal	WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b	standard conditions	Fig. 1 from Ferrante et al., 2011
somite shape, abnormal	WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b	standard conditions	text only from Ferrante et al., 2011
fast muscle cell filamentous actin decreased amount, abnormal	WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b	standard conditions	Fig. 1 from Ferrante et al., 2011
actin filament bundle distribution disrupted, abnormal	WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b	standard conditions	Fig. 2 from Ferrante et al., 2011
striated muscle cell development disrupted, abnormal	WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b	standard conditions	Fig. 1 from Ferrante et al., 2011
skeletal muscle Z disc disorganized, abnormal	WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b	standard conditions	Fig. 1, Fig. 2 from Ferrante et al., 2011
skeletal muscle sarcomere disorganized, abnormal	WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b	standard conditions	Fig. 3 from Ferrante et al., 2011
skeletal muscle M band dispersed, abnormal	WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b	standard conditions	Fig. 2 from Ferrante et al., 2011
whole organism immobile, abnormal	WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b	standard conditions	text only from Ferrante et al., 2011
fast muscle cell myosin filament dispersed, abnormal	WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b	standard conditions	Fig. 2 from Ferrante et al., 2011
sarcomere organization disrupted, abnormal	WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b	standard conditions	Fig. 1 from Ferrante et al., 2011
fast muscle cell myofibril disorganized, abnormal	WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b	standard conditions	Fig. 1 from Ferrante et al., 2011
pericardium edematous, abnormal	WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b	standard conditions	text only from Ferrante et al., 2011
whole organism bent, abnormal	WT + MO1-tnnt2c + MO1-tnnt3a + MO1-tnnt3b	standard conditions	text only from Ferrante et al., 2011

Citations