Morpholino

MO2-irx2a

ID

ZDB-MRPHLNO-110209-1

Name

MO2-irx2a

Previous Names

None

Target

irx2a (1)

Sequence

5' - ACGGAGAGCCCTTCAAAAATAAC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-irx2a

Expressed Gene	Anatomy	Figures
cimap1b	pronephric tubule multi-ciliated epithelial cell	Figure 4 from Marra et al., 2019
etv5a	pronephric tubule	Figure 3 from Marra et al., 2019
irx1a	whole organism	Fig. 2 from Choy et al., 2010
irx2a	whole organism	Fig. 2 from Choy et al., 2010
slc12a3	pronephric distal late tubule	Figure 2 from Marra et al., 2019
trpm7	pronephric proximal straight tubule	Figure 2 from Marra et al., 2019

Phenotype

Phenotype resulting from MO2-irx2a

Phenotype	Fish	Figures
pronephric distal late tubule decreased length, abnormal	TU + MO2-irx2a	Figure 2 from Marra et al., 2019
pronephric distal late tubule pronephric nephron tubule epithelial cell differentiation decreased occurrence, abnormal	TU + MO2-irx2a	Figure 2 from Marra et al., 2019
pronephric proximal straight tubule increased length, abnormal	TU + MO2-irx2a	Figure 2 from Marra et al., 2019
pronephric proximal straight tubule pronephric nephron tubule epithelial cell differentiation increased occurrence, abnormal	TU + MO2-irx2a	Figure 2 from Marra et al., 2019
pronephric tubule etv5a expression decreased distribution, abnormal	TU + MO2-irx2a	Figure 3 from Marra et al., 2019
pronephric tubule has fewer parts of type pronephric tubule multi-ciliated epithelial cell, abnormal	TU + MO2-irx2a	Figure 4 from Marra et al., 2019
pronephric tubule multi-ciliated epithelial cell differentiation decreased occurrence, abnormal	TU + MO2-irx2a	Figure 4 from Marra et al., 2019
retina lacks parts or has fewer parts of type retinal inner plexiform layer, abnormal	WT + MO2-irx2a	Fig. 3 from Choy et al., 2010
retina lacks parts or has fewer parts of type retinal outer plexiform layer, abnormal	WT + MO2-irx2a	Fig. 3 from Choy et al., 2010
retina layer formation disrupted, abnormal	WT + MO2-irx2a	Fig. 3 from Choy et al., 2010
retinal ganglion cell layer hypoplastic, abnormal	WT + MO2-irx2a	Fig. 3 from Choy et al., 2010
retinal inner nuclear layer hypoplastic, abnormal	WT + MO2-irx2a	Fig. 3 from Choy et al., 2010
whole organism lacks all parts of type cranial nerve II, abnormal	WT + MO2-irx2a	Fig. 3 from Choy et al., 2010

Phenotype of all Fish created by or utilizing MO2-irx2a

Phenotype	Fish	Conditions	Figures
pronephric proximal straight tubule pronephric nephron tubule epithelial cell differentiation increased occurrence, abnormal	TU + MO2-irx2a	standard conditions	Figure 2 from Marra et al., 2019
pronephric tubule etv5a expression decreased distribution, abnormal	TU + MO2-irx2a	control	Figure 3 from Marra et al., 2019
pronephric tubule has fewer parts of type pronephric tubule multi-ciliated epithelial cell, abnormal	TU + MO2-irx2a	standard conditions	Figure 4 from Marra et al., 2019
pronephric distal late tubule decreased length, abnormal	TU + MO2-irx2a	standard conditions	Figure 2 from Marra et al., 2019
pronephric proximal straight tubule increased length, abnormal	TU + MO2-irx2a	standard conditions	Figure 2 from Marra et al., 2019
pronephric tubule multi-ciliated epithelial cell differentiation decreased occurrence, abnormal	TU + MO2-irx2a	standard conditions	Figure 4 from Marra et al., 2019
pronephric distal late tubule pronephric nephron tubule epithelial cell differentiation decreased occurrence, abnormal	TU + MO2-irx2a	standard conditions	Figure 2 from Marra et al., 2019
retina layer formation disrupted, abnormal	WT + MO2-irx2a	standard conditions	Fig. 3 from Choy et al., 2010
whole organism lacks all parts of type cranial nerve II, abnormal	WT + MO2-irx2a	standard conditions	Fig. 3 from Choy et al., 2010
retinal ganglion cell layer hypoplastic, abnormal	WT + MO2-irx2a	standard conditions	Fig. 3 from Choy et al., 2010
eye decreased size, abnormal	WT + MO2-irx2a	high light intensity	Fig. 2 from Choy et al., 2010
whole organism increased pigmentation, abnormal	WT + MO2-irx2a	high light intensity	Fig. 2 from Choy et al., 2010
retina lacks parts or has fewer parts of type retinal outer plexiform layer, abnormal	WT + MO2-irx2a	standard conditions	Fig. 3 from Choy et al., 2010
retinal inner nuclear layer hypoplastic, abnormal	WT + MO2-irx2a	standard conditions	Fig. 3 from Choy et al., 2010
retina lacks parts or has fewer parts of type retinal inner plexiform layer, abnormal	WT + MO2-irx2a	standard conditions	Fig. 3 from Choy et al., 2010
eye decreased size, abnormal	WT + MO2-atoh7 + MO2-irx2a	standard conditions	Fig. 6 from Choy et al., 2010
eye decreased size, abnormal	WT + MO2-irx2a + MO4-irx1a	standard conditions	Fig. 6 from Choy et al., 2010

Citations