Morpholino

MO1-prpf4

ID
ZDB-MRPHLNO-110124-3
Name
MO1-prpf4
Previous Names
  • prpf4 -MO (1)
Target
Sequence
5' - TGGAGCTTCATCTTCATCTGACATC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
View all 3 target locations
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-prpf4
Phenotype
Phenotype resulting from MO1-prpf4
Phenotype of all Fish created by or utilizing MO1-prpf4
Citations