Morpholino
MO5-grna
- ID
- ZDB-MRPHLNO-101229-1
- Name
- MO5-grna
- Previous Names
- None
- Target
- Sequence
-
5' - TTGAGCAGGTGGATTTGTGAACAGC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Targets the 5'UTR.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-grna
No data available
Phenotype
Phenotype resulting from MO5-grna
No data available
Phenotype of all Fish created by or utilizing MO5-grna
1 - 5 of 11 Show all
Citations
- Campbell, C.A., Fursova, O., Cheng, X., Snella, E., McCune, A., Li, L., Solchenberger, B., Schmid, B., Sahoo, D., Morton, M., Traver, D., Espín-Palazón, R. (2021) A zebrafish model of granulin deficiency reveals essential roles in myeloid cell differentiation. Blood advances. 5:796-811
- Li, Y.W., Chiang, K.Y., Li, Y.H., Wu, S.Y., Liu, W., Lin, C.R., Wu, J.L. (2017) MiR-145 mediates zebrafish hepatic outgrowth through progranulin A signaling. PLoS One. 12:e0177887
- Li, Y.H., Chen, H.Y., Li, Y.W., Wu, S.Y., Wangta, L., Lin, G.H., Hu, S.Y., Chang, Z.K., Gong, H.Y., Liao, C.H., Chiang, K.Y., Huang, C.W., and Wu, J.L. (2013) Progranulin regulates zebrafish muscle growth and regeneration through maintaining the pool of myogenic progenitor cells. Scientific Reports. 3:1176
- Li, Y.H., Chen, M.H., Gong, H.Y., Hu, S.Y., Li, Y.W., Lin, G.H., Lin, C.C., Liu, W., and Wu, J.L. (2010) Progranulin A-mediated MET signaling is essential for liver morphogenesis in zebrafish. The Journal of biological chemistry. 285(52):41001-41009
1 - 4 of 4
Show