Morpholino

MO1-apobb.1

ID

ZDB-MRPHLNO-101207-2

Name

MO1-apobb.1

Previous Names

MO1-apobl (1)

Target

apobb.1 (1)

Sequence

5' - CCATGATGGGTTCAGGTAAGCTCGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-apobb.1

Expressed Gene	Anatomy	Figures
atoh7	retinal ganglion cell	Fig. 7 from Seth et al., 2010
fabp2	intestine	Figure 3 from Templehof et al., 2021
fabp10a	liver	Figure 2 from Templehof et al., 2021
foxa2	intestine	Figure 2 from Templehof et al., 2021
isl1a	(not) eye	Fig. 7 from Seth et al., 2010
pax2a	optic stalk	Fig. 7 from Seth et al., 2010
prox1a	liver	Figure 2 from Templehof et al., 2021
tfa	liver	Figure 2 from Templehof et al., 2021

Phenotype

Phenotype resulting from MO1-apobb.1

Phenotype	Fish	Figures
optic stalk decreased length, abnormal	AB + MO1-apobb.1	Fig. 7 from Seth et al., 2010
optic stalk increased thickness, abnormal	AB + MO1-apobb.1	Fig. 7 from Seth et al., 2010
retinal ganglion cell decreased amount, abnormal	AB + MO1-apobb.1	Fig. 7 from Seth et al., 2010
whole organism lacks all parts of type optic chiasm, abnormal	AB + MO1-apobb.1	Fig. 7 from Seth et al., 2010

Phenotype of all Fish created by or utilizing MO1-apobb.1

Phenotype	Fish	Conditions	Figures
optic stalk increased thickness, abnormal	AB + MO1-apobb.1	standard conditions	Fig. 7 from Seth et al., 2010
whole organism lacks all parts of type optic chiasm, abnormal	AB + MO1-apobb.1	standard conditions	Fig. 7 from Seth et al., 2010
retinal ganglion cell decreased amount, abnormal	AB + MO1-apobb.1	standard conditions	Fig. 7 from Seth et al., 2010
optic stalk decreased length, abnormal	AB + MO1-apobb.1	standard conditions	Fig. 7 from Seth et al., 2010
liver bilaterally paired, abnormal	apoba^wz26/wz26 + MO1-apobb.1	standard conditions	Figure 2 from Templehof et al., 2021
liver hepatocyte has extra parts of type hepatocyte lipid droplet, abnormal	apoba^wz26/wz26 + MO1-apobb.1	standard conditions	Figure 2 from Templehof et al., 2021
subintestinal venous plexus sprouting angiogenesis increased occurrence, abnormal	apoba^wz26/wz26 + MO1-apobb.1	standard conditions	Figure 4 from Templehof et al., 2021
liver tfa expression spatial pattern, abnormal	apoba^wz26/wz26 + MO1-apobb.1	standard conditions	Figure 2 from Templehof et al., 2021
liver fatty, abnormal	apoba^wz26/wz26 + MO1-apobb.1	standard conditions	Figure 2 from Templehof et al., 2021
determination of liver left/right asymmetry decreased process quality, abnormal	apoba^wz26/wz26 + MO1-apobb.1	standard conditions	Figure 2 from Templehof et al., 2021
subintestinal venous plexus sprouting angiogenesis increased occurrence, abnormal	apoba^wz26/wz26 + MO1-apobb.1	chemical treatment by environment: oleate	Figure 4 from Templehof et al., 2021
subintestinal venous plexus has extra parts of type subintestinal venous plexus angiogenic sprout, abnormal	apoba^wz26/wz26 + MO1-apobb.1	standard conditions	Figure 4 from Templehof et al., 2021
intestinal epithelium has fewer parts of type goblet cell, abnormal	apoba^wz26/wz26 + MO1-apobb.1	standard conditions	Figure 3 from Templehof et al., 2021
liver prox1a expression spatial pattern, abnormal	apoba^wz26/wz26 + MO1-apobb.1	standard conditions	Figure 2 from Templehof et al., 2021
subintestinal venous plexus sprouting angiogenesis occurrence, ameliorated	apoba^wz26/wz26 + MO1-apobb.1	chemical treatment by injection: low-density lipoprotein	Figure 4 from Templehof et al., 2021
subintestinal venous plexus has number of subintestinal venous plexus angiogenic sprout, ameliorated	apoba^wz26/wz26 + MO1-apobb.1	chemical treatment by injection: low-density lipoprotein	Figure 4 from Templehof et al., 2021
liver fabp10a expression decreased amount, abnormal	apoba^wz26/wz26 + MO1-apobb.1	standard conditions	Figure 2 from Templehof et al., 2021
subintestinal venous plexus has extra parts of type subintestinal venous plexus angiogenic sprout, abnormal	apoba^wz26/wz26 + MO1-apobb.1	chemical treatment by environment: oleate	Figure 4 from Templehof et al., 2021
whole organism cholesterol decreased amount, abnormal	apoba^wz26/wz26 + MO1-apobb.1	standard conditions	Figure 1 from Templehof et al., 2021
liver decreased size, abnormal	apoba^wz26/wz26 + MO1-apobb.1	standard conditions	Figure 2 from Templehof et al., 2021
whole organism triglyceride decreased amount, abnormal	apoba^wz26/wz26 + MO1-apobb.1	standard conditions	Figure 1 from Templehof et al., 2021
liver EGFP expression decreased amount, abnormal	apoba^wz26/wz26; as3Tg + MO1-apobb.1	standard conditions	Figure 2 from Templehof et al., 2021
liver decreased size, abnormal	apoba^wz26/wz26; as3Tg + MO1-apobb.1	standard conditions	Figure 2 from Templehof et al., 2021
liver Notch signaling pathway decreased occurrence, abnormal	apoba^wz26/wz26; ia12Tg + MO1-apobb.1	standard conditions	Figure 2 from Templehof et al., 2021
intestine EGFP expression increased amount, abnormal	apoba^wz26/wz26; ia12Tg + MO1-apobb.1	standard conditions	Figure 3 from Templehof et al., 2021
liver EGFP expression decreased amount, abnormal	apoba^wz26/wz26; ia12Tg + MO1-apobb.1	standard conditions	Figure 2 from Templehof et al., 2021
intestine Notch signaling pathway increased occurrence, abnormal	apoba^wz26/wz26; ia12Tg + MO1-apobb.1	standard conditions	Figure 3 from Templehof et al., 2021
subintestinal venous plexus Notch signaling pathway increased occurrence, abnormal	apoba^wz26/wz26; ia12Tg; um13Tg + MO1-apobb.1	standard conditions	Figure 4 from Templehof et al., 2021
subintestinal venous plexus sprouting angiogenesis increased occurrence, abnormal	apoba^wz26/wz26; ia12Tg; um13Tg + MO1-apobb.1	standard conditions	Figure 4 from Templehof et al., 2021
intestine lumen increased diameter, abnormal	apoba^wz26/wz26; pd1034Tg + MO1-apobb.1	standard conditions	Figure 3 from Templehof et al., 2021
intestinal epithelium has fewer parts of type intestinal epithelium microvillus, abnormal	apoba^wz26/wz26; pd1034Tg + MO1-apobb.1	standard conditions	Figure 3 from Templehof et al., 2021
intestine shape, abnormal	apoba^wz26/wz26; pd1034Tg + MO1-apobb.1	standard conditions	Figure 3 from Templehof et al., 2021
subintestinal venous plexus has extra parts of type subintestinal venous plexus angiogenic sprout, abnormal	apoba^wz26/wz26; y1Tg + MO1-apobb.1	standard conditions	Figure 4 from Templehof et al., 2021
subintestinal venous plexus sprouting angiogenesis increased occurrence, abnormal	apoba^wz26/wz26; y1Tg + MO1-apobb.1	standard conditions	Figure 4 from Templehof et al., 2021

Citations