Morpholino
MO2-gmds
- ID
- ZDB-MRPHLNO-101118-4
- Name
- MO2-gmds
- Previous Names
- None
- Target
- Sequence
-
5' - CGTATGTTTGCTGACCATAAGGCGA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-gmds
No data available
Phenotype
Phenotype resulting from MO2-gmds
1 - 5 of 8 Show all
Phenotype of all Fish created by or utilizing MO2-gmds
Phenotype | Fish | Conditions | Figures |
---|---|---|---|
brain vasculature hemorrhagic, abnormal | AB + MO2-gmds | control |
Fig. 1 ![]() |
post-vent region curved, abnormal | AB + MO2-gmds | control |
Fig. 1 ![]() |
thigmotaxis decreased process quality, abnormal | AB + MO2-gmds | control |
Fig. 1 ![]() |
brain vasculature mislocalised, abnormal | AB + MO2-gmds | control |
Fig. 4 ![]() |
axon guidance disrupted, abnormal | WT + MO2-gmds | standard conditions |
Fig. 6 ![]() |
1 - 5 of 8 Show all
Citations
- Fowler, G., French, D., Rose, A., Squires, P., Anecito da Silva, C., Ohata, S., Okamoto, H., French, C.R. (2021) Protein fucosylation is required for Notch dependent vascular integrity in zebrafish. Developmental Biology. 480:62-68
- Song, Y., Willer, J.R., Scherer, P.C., Panzer, J.A., Kugath, A., Skordalakes, E., Gregg, R.G., Willer, G.B., and Balice-Gordon, R.J. (2010) Neural and Synaptic Defects in slytherin, a Zebrafish Model for Human Congenital Disorders of Glycosylation. PLoS One. 5(10):e13743
1 - 2 of 2
Show