Morpholino
MO1-cftr
- ID
- ZDB-MRPHLNO-101104-1
- Name
- MO1-cftr
- Previous Names
-
- CFTR I1E2 MO (1)
- Target
- Sequence
-
5' - CCACCTGTAAATATTCAGAGCAGAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO, targets I1E2 boundary.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cftr
No data available
Phenotype
Phenotype resulting from MO1-cftr
No data available
Phenotype of all Fish created by or utilizing MO1-cftr
1 - 5 of 33 Show all
Citations
- Cafora, M., Poerio, N., Forti, F., Loberto, N., Pin, D., Bassi, R., Aureli, M., Briani, F., Pistocchi, A., Fraziano, M. (2022) Evaluation of phages and liposomes as combination therapy to counteract Pseudomonas aeruginosa infection in wild-type and CFTR-null models. Frontiers in microbiology. 13:979610
- Cafora, M., Brix, A., Forti, F., Loberto, N., Aureli, M., Briani, F., Pistocchi, A. (2020) Phages as immunomodulators and their promising use as anti-inflammatory agents in a cftr loss-of-function zebrafish model. Journal of cystic fibrosis : official journal of the European Cystic Fibrosis Society. 20(6):1046-1052
- Cafora, M., Forti, F., Briani, F., Ghisotti, D., Pistocchi, A. (2020) Phage Therapy Application to Counteract Pseudomonas aeruginosa Infection in Cystic Fibrosis Zebrafish Embryos. Journal of visualized experiments : JoVE. (159):
- Cafora, M., Deflorian, G., Forti, F., Ferrari, L., Binelli, G., Briani, F., Ghisotti, D., Pistocchi, A. (2019) Phage therapy against Pseudomonas aeruginosa infections in a cystic fibrosis zebrafish model. Scientific Reports. 9:1527
- Phennicie, R.T., Sullivan, M.J., Singer, J.T., Yoder, J.A., and Kim, C.H. (2010) Specific Resistance to Pseudomonas aeruginosa Infection in Zebrafish is Mediated by the Cystic Fibrosis Transmembrane Conductance Regulator. Infection and Immunity. 78(11):4542-4550
1 - 5 of 5
Show