Morpholino
MO1-smyhc1
- ID
- ZDB-MRPHLNO-100902-2
- Name
- MO1-smyhc1
- Previous Names
- None
- Target
- Sequence
-
5' - AACGGCGTCACCCATTTTGAAATCT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Targets start site
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-smyhc1
No data available
Phenotype
Phenotype resulting from MO1-smyhc1
1 - 5 of 6 Show all
Phenotype of all Fish created by or utilizing MO1-smyhc1
1 - 5 of 6 Show all
Citations
- Li, S., Wen, H., Du, S. (2020) Defective sarcomere organization and reduced larval locomotion and fish survival in slow muscle heavy chain 1 (smyhc1) mutants. FASEB journal : official publication of the Federation of American Societies for Experimental Biology. 34:1378-1397
- Xu, J., Gao, J., Li, J., Xue, L., Clark, K.J., Ekker, S.C., and Du, S.J. (2012) Functional analysis of slow Myosin heavy chain 1 and myomesin-3 in sarcomere organization in zebrafish embryonic slow muscles. Journal of genetics and genomics = Yi chuan xue bao. 39(2):69-80
- Codina, M., Li, J., Gutiérrez, J., Kao, J.P., and Du, S.J. (2010) Loss of Smyhc1 or Hsp90alpha1 function results in different effects on myofibril organization in skeletal muscles of zebrafish embryos. PLoS One. 5(1):e8416
1 - 3 of 3
Show