Morpholino
MO1-pdgfrb
- ID
- ZDB-MRPHLNO-100806-7
- Name
- MO1-pdgfrb
- Previous Names
-
- MO1-pdgfrb2
- Target
- Sequence
-
5' - ACAGGAACTGAAGTCACTGACCTTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-pdgfrb
No data available
Phenotype
Phenotype resulting from MO1-pdgfrb
Phenotype | Fish | Figures |
---|---|---|
intersegmental vessel decreased amount, abnormal | s843Tg + MO1-pdgfrb |
Fig. 5 ![]() |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO1-pdgfrb
1 - 5 of 9 Show all
Citations
- Mao, A., Li, Z., Ning, G., Zhou, Z., Wei, C., Li, J., He, X., Wang, Q. (2023) Sclerotome-derived PDGF signaling functions as a niche cue responsible for primitive erythropoiesis. Development (Cambridge, England). 150(22):
- Damm, E.W., Clements, W.K. (2017) Pdgf signalling guides neural crest contribution to the haematopoietic stem cell specification niche. Nature cell biology. 19(5):457-467
- Lim, S.E., Esain, V., Kwan, W., Theodore, L.N., Cortes, M., Frost, I.M., Liu, S.Y., North, T.E. (2017) HIF1α-induced PDGFRβ signaling promotes developmental HSC production via IL-6 activation. Experimental hematology. 46:83-95.e6
- French, C.R., Seshadri, S., Destefano, A.L., Fornage, M., Arnold, C.R., Gage, P.J., Skarie, J.M., Dobyns, W.B., Millen, K.J., Liu, T., Dietz, W., Kume, T., Hofker, M., Emery, D.J., Childs, S.J., Waskiewicz, A.J., Lehmann, O.J. (2014) Mutation of FOXC1 and PITX2 induces cerebral small-vessel disease. J. Clin. Invest.. 124(11):4877-81
- Wiens, K.M., Lee, H.L., Shimada, H., Metcalf, A.E., Chao, M.Y., and Lien, C.L. (2010) Platelet-derived growth factor receptor Beta is critical for zebrafish intersegmental vessel formation. PLoS One. 5(6):e11324
1 - 5 of 5
Show