Morpholino

MO1-tgfb3

ID
ZDB-MRPHLNO-100630-2
Name
MO1-tgfb3
Previous Names
  • i1e2 MO (1)
Target
Sequence
5' - TCATCTGCAAGGTCAGAGGTCAGCG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tgfb3
No data available
Phenotype
Phenotype resulting from MO1-tgfb3
Phenotype Fish Figures
basihyal cartilage aplastic, abnormal SING + MO1-tgfb3 Fig. S1 with image from Cheah et al., 2010
cranial cartilage hypoplastic, abnormal SING + MO1-tgfb3 Fig. S1 with image from Cheah et al., 2010
head decreased size, abnormal SING + MO1-tgfb3 Fig. 1 with image from Cheah et al., 2010
heart decreased size, abnormal SING + MO1-tgfb3 Fig. 1 with image from Cheah et al., 2010
hyosymplectic cartilage hypoplastic, abnormal SING + MO1-tgfb3 Fig. S1 with image from Cheah et al., 2010
Meckel's cartilage hypoplastic, abnormal SING + MO1-tgfb3 Fig. S1 with image from Cheah et al., 2010
mouth ventrally rotated head, abnormal SING + MO1-tgfb3 Fig. S1 with image from Cheah et al., 2010
neurocranium decreased size, abnormal SING + MO1-tgfb3 Fig. S1 with image from Cheah et al., 2010
palatoquadrate cartilage hypoplastic, abnormal SING + MO1-tgfb3 Fig. S1 with image from Cheah et al., 2010
pericardium increased size, abnormal SING + MO1-tgfb3 Fig. 1 with image from Cheah et al., 2010
pharyngeal arch 3-7 skeleton hypoplastic, abnormal SING + MO1-tgfb3 Fig. S1 with image from Cheah et al., 2010
ventral mandibular arch malformed, abnormal SING + MO1-tgfb3 Fig. 1 with image from Cheah et al., 2010
Phenotype of all Fish created by or utilizing MO1-tgfb3
Phenotype Fish Conditions Figures
palatoquadrate cartilage hypoplastic, abnormal SING + MO1-tgfb3 standard conditions Fig. S1 with image from Cheah et al., 2010
mouth ventrally rotated head, abnormal SING + MO1-tgfb3 standard conditions Fig. S1 with image from Cheah et al., 2010
Meckel's cartilage hypoplastic, abnormal SING + MO1-tgfb3 standard conditions Fig. S1 with image from Cheah et al., 2010
ventral mandibular arch malformed, abnormal SING + MO1-tgfb3 standard conditions Fig. 1 with image from Cheah et al., 2010
pericardium increased size, abnormal SING + MO1-tgfb3 standard conditions Fig. 1 with image from Cheah et al., 2010
neurocranium decreased size, abnormal SING + MO1-tgfb3 standard conditions Fig. S1 with image from Cheah et al., 2010
head decreased size, abnormal SING + MO1-tgfb3 standard conditions Fig. 1 with image from Cheah et al., 2010
cranial cartilage hypoplastic, abnormal SING + MO1-tgfb3 standard conditions Fig. S1 with image from Cheah et al., 2010
basihyal cartilage aplastic, abnormal SING + MO1-tgfb3 standard conditions Fig. S1 with image from Cheah et al., 2010
heart decreased size, abnormal SING + MO1-tgfb3 standard conditions Fig. 1 with image from Cheah et al., 2010
hyosymplectic cartilage hypoplastic, abnormal SING + MO1-tgfb3 standard conditions Fig. S1 with image from Cheah et al., 2010
pharyngeal arch 3-7 skeleton hypoplastic, abnormal SING + MO1-tgfb3 standard conditions Fig. S1 with image from Cheah et al., 2010
maxilla ossified, abnormal SING + MO1-tgfb3 + MO2-tgfb3 standard conditions Fig. 4 with image from Cheah et al., 2010
ceratohyal bone ossified, abnormal SING + MO1-tgfb3 + MO2-tgfb3 standard conditions Fig. 4 with image from Cheah et al., 2010
cleithrum ossified, abnormal SING + MO1-tgfb3 + MO2-tgfb3 standard conditions Fig. 4 with image from Cheah et al., 2010
mouth ventrally rotated head, abnormal SING + MO1-tgfb3 + MO2-tgfb3 standard conditions Fig. 2 with image from Cheah et al., 2010
opercle ossified, abnormal SING + MO1-tgfb3 + MO2-tgfb3 standard conditions Fig. 4 with image from Cheah et al., 2010
hyomandibula ossified, abnormal SING + MO1-tgfb3 + MO2-tgfb3 standard conditions Fig. 4 with image from Cheah et al., 2010
palatoquadrate cartilage hypoplastic, abnormal SING + MO1-tgfb3 + MO2-tgfb3 standard conditions Fig. 2 with image from Cheah et al., 2010
pharyngeal arch 3-7 skeleton hypoplastic, abnormal SING + MO1-tgfb3 + MO2-tgfb3 standard conditions Fig. 2 with image from Cheah et al., 2010
parasphenoid ossified, abnormal SING + MO1-tgfb3 + MO2-tgfb3 standard conditions Fig. 4 with image from Cheah et al., 2010
notochordal ossification ossified, abnormal SING + MO1-tgfb3 + MO2-tgfb3 standard conditions Fig. 4 with image from Cheah et al., 2010
pericardium increased size, abnormal SING + MO1-tgfb3 + MO2-tgfb3 standard conditions Fig. 1 with image from Cheah et al., 2010
heart decreased size, abnormal SING + MO1-tgfb3 + MO2-tgfb3 standard conditions Fig. 1 with image from Cheah et al., 2010
Meckel's cartilage hypoplastic, abnormal SING + MO1-tgfb3 + MO2-tgfb3 standard conditions Fig. 2 with image from Cheah et al., 2010
hyosymplectic cartilage hypoplastic, abnormal SING + MO1-tgfb3 + MO2-tgfb3 standard conditions Fig. 2 with image from Cheah et al., 2010
branchiostegal ray osteoblast poorly differentiated, abnormal SING + MO1-tgfb3 + MO2-tgfb3 standard conditions Fig. 5 with image from Cheah et al., 2010
quadrate ossified, abnormal SING + MO1-tgfb3 + MO2-tgfb3 standard conditions Fig. 4 with image from Cheah et al., 2010
opercle osteoblast poorly differentiated, abnormal SING + MO1-tgfb3 + MO2-tgfb3 standard conditions Fig. 5 with image from Cheah et al., 2010
basihyal cartilage aplastic, abnormal SING + MO1-tgfb3 + MO2-tgfb3 standard conditions Fig. 2 with image from Cheah et al., 2010
cartilage development process quality, abnormal SING + MO1-tgfb3 + MO2-tgfb3 standard conditions Fig. 3 with image from Cheah et al., 2010
head decreased size, abnormal SING + MO1-tgfb3 + MO2-tgfb3 standard conditions Fig. 1 with image from Cheah et al., 2010
cranial cartilage hypoplastic, abnormal SING + MO1-tgfb3 + MO2-tgfb3 standard conditions Fig. 2 with image from Cheah et al., 2010
entopterygoid ossified, abnormal SING + MO1-tgfb3 + MO2-tgfb3 standard conditions Fig. 4 with image from Cheah et al., 2010
ventral mandibular arch malformed, abnormal SING + MO1-tgfb3 + MO2-tgfb3 standard conditions Fig. 1 with image from Cheah et al., 2010
branchiostegal ray ossified, abnormal SING + MO1-tgfb3 + MO2-tgfb3 standard conditions Fig. 4 with image from Cheah et al., 2010
vertebra ossified, abnormal SING + MO1-tgfb3 + MO2-tgfb3 standard conditions Fig. 4 with image from Cheah et al., 2010
ceratobranchial 5 bone ossified, abnormal SING + MO1-tgfb3 + MO2-tgfb3 standard conditions Fig. 4 with image from Cheah et al., 2010
neurocranium decreased size, abnormal SING + MO1-tgfb3 + MO2-tgfb3 standard conditions Fig. 2 with image from Cheah et al., 2010
apoptotic process increased occurrence, abnormal y1Tg + MO1-tgfb3 + MO2-tgfb3 standard conditions Fig. 7 with image from Cheah et al., 2010
pharyngeal arch apoptotic, abnormal y1Tg + MO1-tgfb3 + MO2-tgfb3 standard conditions Fig. 7 with image from Cheah et al., 2010
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.