Morpholino

MO1-etv5a

ID
ZDB-MRPHLNO-100621-4
Name
MO1-etv5a
Previous Names
None
Target
Sequence
5' - ATACATTAGGGAGTACCTGTAGCTG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-etv5a
Expressed Gene Anatomy Figures
cetn4 Fig. 3 with image from Marra et al., 2016
cimap1b Fig. 5 with image from Marra et al., 2019
Fig. 2 with image,  Fig. 3 with image,  Fig. 4 with image,  Fig. 5 with image,  Fig. 6 with image from Marra et al., 2016
irx2a Figure 3 with image from Marra et al., 2019
Phenotype
Phenotype resulting from MO1-etv5a
Phenotype Fish Figures
head decreased size, abnormal WT + MO1-etv5a Fig. 2 with image from Marra et al., 2016
head hemorrhagic, abnormal WT + MO1-etv5a Fig. 2 with image from Marra et al., 2016
heart edematous, abnormal WT + MO1-etv5a Fig. 2 with image from Marra et al., 2016
pronephric duct cimap1b expression decreased distribution, abnormal TU + MO1-etv5a Fig. 5 with image from Marra et al., 2019
pronephric duct multi-ciliated epithelial cell decreased amount, abnormal TU + MO1-etv5a Fig. 5 with image from Marra et al., 2019
pronephric nephron tubule epithelial cell differentiation process quality, abnormal WT + MO1-etv5a Fig. 2 with image,  Fig. 3 with image,  Fig. 4 with image,  Fig. 5 with image,  Fig. 6 with image from Marra et al., 2016
pronephric proximal straight tubule has fewer parts of type pronephric proximal straight tubule multi-ciliated epithelial cell, abnormal WT + MO1-etv5a Fig. 3 with image from Marra et al., 2016
pronephros cimap1b expression decreased distribution, abnormal WT + MO1-etv5a Fig. 5 with image,  Fig. 6 with image from Marra et al., 2016
pronephros has fewer parts of type pronephros multi-ciliated epithelial cell, abnormal WT + MO1-etv5a Fig. 2 with image,  Fig. 4 with image,  Fig. 5 with image,  Fig. 6 with image from Marra et al., 2016
pronephros multi-ciliated epithelial cell differentiation decreased occurrence, abnormal WT + MO1-etv5a Fig. 2 with image,  Fig. 3 with image,  Fig. 4 with image,  Fig. 5 with image,  Fig. 6 with image from Marra et al., 2016
renal system process decreased occurrence, abnormal WT + MO1-etv5a Fig. 2 with image from Marra et al., 2016
Phenotype of all Fish created by or utilizing MO1-etv5a
Phenotype Fish Conditions Figures
pronephric duct cimap1b expression decreased distribution, abnormal TU + MO1-etv5a chemical treatment by environment: prostaglandin E2 Fig. 5 with image from Marra et al., 2019
pronephric duct multi-ciliated epithelial cell decreased amount, ameliorated TU + MO1-etv5a chemical treatment by environment: prostaglandin E2 Fig. 5 with image from Marra et al., 2019
pronephric duct multi-ciliated epithelial cell decreased amount, abnormal TU + MO1-etv5a control Fig. 5 with image from Marra et al., 2019
pronephric duct cimap1b expression decreased distribution, abnormal TU + MO1-etv5a control Fig. 5 with image from Marra et al., 2019
head hemorrhagic, abnormal WT + MO1-etv5a standard conditions Fig. 2 with image from Marra et al., 2016
pronephros cimap1b expression spatial pattern, ameliorated WT + MO1-etv5a chemical treatment: all-trans-retinoic acid Fig. 5 with image from Marra et al., 2016
head decreased size, abnormal WT + MO1-etv5a standard conditions Fig. 2 with image from Marra et al., 2016
pronephric nephron tubule epithelial cell differentiation process quality, abnormal WT + MO1-etv5a chemical treatment: 4-(diethylamino)benzaldehyde Fig. 5 with image from Marra et al., 2016
pronephric proximal straight tubule has fewer parts of type pronephric proximal straight tubule multi-ciliated epithelial cell, abnormal WT + MO1-etv5a standard conditions Fig. 3 with image from Marra et al., 2016
pronephros cimap1b expression decreased distribution, abnormal WT + MO1-etv5a control Fig. 5 with image,  Fig. 6 with image from Marra et al., 2016
pronephric nephron tubule epithelial cell differentiation process quality, abnormal WT + MO1-etv5a chemical treatment: DAPT Fig. 6 with image from Marra et al., 2016
pronephros cimap1b expression absent, abnormal WT + MO1-etv5a chemical treatment: 4-(diethylamino)benzaldehyde Fig. 5 with image from Marra et al., 2016
pronephros multi-ciliated epithelial cell differentiation occurrence, ameliorated WT + MO1-etv5a chemical treatment: all-trans-retinoic acid Fig. 5 with image from Marra et al., 2016
pronephric nephron tubule epithelial cell differentiation process quality, abnormal WT + MO1-etv5a standard conditions Fig. 2 with image,  Fig. 3 with image,  Fig. 4 with image,  Fig. 5 with image,  Fig. 6 with image from Marra et al., 2016
pronephros multi-ciliated epithelial cell differentiation increased occurrence, abnormal WT + MO1-etv5a chemical treatment: DAPT Fig. 6 with image from Marra et al., 2016
pronephros has fewer parts of type pronephros multi-ciliated epithelial cell, abnormal WT + MO1-etv5a standard conditions Fig. 2 with image,  Fig. 4 with image,  Fig. 5 with image,  Fig. 6 with image from Marra et al., 2016
renal system process decreased occurrence, abnormal WT + MO1-etv5a standard conditions Fig. 2 with image from Marra et al., 2016
heart edematous, abnormal WT + MO1-etv5a standard conditions Fig. 2 with image from Marra et al., 2016
pronephros multi-ciliated epithelial cell differentiation arrested, abnormal WT + MO1-etv5a chemical treatment: 4-(diethylamino)benzaldehyde Fig. 5 with image from Marra et al., 2016
pronephric proximal straight tubule has number of pronephric proximal straight tubule multi-ciliated epithelial cell, ameliorated WT + MO1-etv5a chemical treatment: all-trans-retinoic acid Fig. 5 with image from Marra et al., 2016
pronephros has extra parts of type pronephros multi-ciliated epithelial cell, abnormal WT + MO1-etv5a chemical treatment: DAPT Fig. 6 with image from Marra et al., 2016
pronephric nephron tubule epithelial cell differentiation process quality, ameliorated WT + MO1-etv5a chemical treatment: all-trans-retinoic acid Fig. 5 with image from Marra et al., 2016
pronephric proximal straight tubule lacks all parts of type pronephric proximal straight tubule multi-ciliated epithelial cell, abnormal WT + MO1-etv5a chemical treatment: 4-(diethylamino)benzaldehyde Fig. 5 with image from Marra et al., 2016
pronephros cimap1b expression increased distribution, abnormal WT + MO1-etv5a chemical treatment: DAPT Fig. 6 with image from Marra et al., 2016
pronephros multi-ciliated epithelial cell differentiation decreased occurrence, abnormal WT + MO1-etv5a standard conditions Fig. 2 with image,  Fig. 3 with image,  Fig. 4 with image,  Fig. 5 with image,  Fig. 6 with image from Marra et al., 2016
pronephric nephron tubule epithelial cell differentiation process quality, abnormal WT + MO1-etv5a + MO2-etv4 standard conditions Fig. 4 with image from Marra et al., 2016
pronephros has fewer parts of type pronephros multi-ciliated epithelial cell, abnormal WT + MO1-etv5a + MO2-etv4 standard conditions Fig. 4 with image from Marra et al., 2016
pronephros multi-ciliated epithelial cell differentiation decreased occurrence, abnormal WT + MO1-etv5a + MO2-etv4 standard conditions Fig. 4 with image from Marra et al., 2016
pectoral fin bud decreased size, abnormal WT + MO1-etv5a + MO2-etv4 + MO2-etv5b standard conditions Fig. 3 with image from Mao et al., 2009
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.