Morpholino
MO2-etv4
- ID
- ZDB-MRPHLNO-100617-9
- Name
- MO2-etv4
- Previous Names
-
- MO2-pea3 (1)
- Target
- Sequence
-
5' - TTAAAAGTCTAATGTTTACCTCCTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-etv4
No data available
Phenotype
Phenotype resulting from MO2-etv4
1 - 3 of 3
Phenotype of all Fish created by or utilizing MO2-etv4
1 - 5 of 7 Show all
Citations
- Kawamura, A., Ovara, H., Ooka, Y., Kinoshita, H., Hoshikawa, M., Nakajo, K., Yokota, D., Fujino, Y., Higashijima, S.I., Takada, S., Yamasu, K. (2016) Posterior-anterior gradient of zebrafish hes6 expression in the presomitic mesoderm is established by the combinatorial functions of the downstream enhancer and 3'UTR. Developmental Biology. 409(2):543-54
- Marra, A.N., Wingert, R.A. (2016) Epithelial cell fate in the nephron tubule is mediated by the ETS transcription factors etv5a and etv4 during zebrafish kidney development. Developmental Biology. 411(2):231-45
- Mao, J., McGlinn, E., Huang, P., Tabin, C.J., and McMahon, A.P. (2009) Fgf-dependent Etv4/5 activity is required for posterior restriction of Sonic Hedgehog and promoting outgrowth of the vertebrate limb. Developmental Cell. 16(4):600-606
1 - 3 of 3
Show