Morpholino

MO1-rest

ID
ZDB-MRPHLNO-100614-4
Name
MO1-rest
Previous Names
None
Target
Sequence
5' - GGCCTTTCACCTGTAAAATACAGAA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-rest
Phenotype
Phenotype resulting from MO1-rest
Phenotype of all Fish created by or utilizing MO1-rest
Phenotype Fish Conditions Figures
neural tube wholly ventralized, abnormal WT + MO1-rest standard conditions Fig. 2 with image from Gates et al., 2010
regulation of smoothened signaling pathway disrupted, abnormal WT + MO1-rest standard conditions Fig. 2 with image from Gates et al., 2010
embryo development decreased rate, abnormal WT + MO1-rest standard conditions text only from Gates et al., 2010
smoothened signaling pathway involved in dorsal/ventral neural tube patterning disrupted, abnormal WT + MO1-rest standard conditions Fig. 2 with image from Gates et al., 2010
whole organism decreased size, abnormal WT + MO1-rest standard conditions text only from Gates et al., 2010
dorsal/ventral neural tube patterning disrupted, abnormal WT + MO1-rest standard conditions Fig. 2 with image from Gates et al., 2010
neuron migration process quality, abnormal rw0Tg + MO1-rest standard conditions Fig. 5 with image from Mapp et al., 2011
facial nerve motor nucleus mislocalised anteriorly, abnormal rw0Tg + MO1-rest standard conditions Fig. 5 with image from Mapp et al., 2011
facial nerve motor nucleus motor neuron migration decreased occurrence, abnormal rw0Tg + MO1-rest + MO5-rest control Fig. 1 with image from Love et al., 2015
rhombomere 6 has fewer parts of type facial nerve motor nucleus motor neuron, abnormal rw0Tg + MO1-rest + MO5-rest control Fig. 1 with image from Love et al., 2015
facial nerve motor nucleus motor neuron displaced to rhombomere 4, abnormal rw0Tg + MO1-rest + MO5-rest control Fig. 1 with image from Love et al., 2015
facial nerve motor nucleus motor neuron displaced to rhombomere 5, abnormal rw0Tg + MO1-rest + MO5-rest control Fig. 1 with image from Love et al., 2015
Citations