Morpholino
MO1-rest
- ID
- ZDB-MRPHLNO-100614-4
- Name
- MO1-rest
- Previous Names
- None
- Target
- Sequence
-
5' - GGCCTTTCACCTGTAAAATACAGAA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-rest
No data available
Phenotype
Phenotype resulting from MO1-rest
1 - 5 of 8 Show all
Phenotype of all Fish created by or utilizing MO1-rest
1 - 5 of 12 Show all
Citations
- Love, C.E., Prince, V.E. (2015) Rest represses maturation within migrating facial branchiomotor neurons. Developmental Biology. 401(2):220-35
- Bergeron, S.A., Hannan, M.C., Codore, H., Fero, K., Li, G.H., Moak, Z., Yokogawa, T., and Burgess, H.A. (2012) Brain selective transgene expression in zebrafish using an NRSE derived motif. Frontiers in neural circuits. 6:110
- Xie, X., Mathias, J.R., Smith, M.A., Walker, S.L., Teng, Y., Distel, M., Koster, R.W., Sirotkin, H.I., Saxena, M.T., and Mumm, J.S. (2012) Silencer-delimited transgenesis: NRSE/RE1 sequences promote neural-specific transgene expression in a NRSF/REST-dependent manner. BMC Biology. 10:93
- Mapp, O.M., Walsh, G.S., Moens, C.B., Tada, M., and Prince, V.E. (2011) Zebrafish Prickle1b mediates facial branchiomotor neuron migration via a farnesylation-dependent nuclear activity. Development (Cambridge, England). 138(10):2121-2132
- Gates, K.P., Mentzer, L., Karlstrom, R.O., and Sirotkin, H.I. (2010) The transcriptional repressor REST/NRSF modulates hedgehog signaling. Developmental Biology. 340(2):293-305
1 - 5 of 5
Show