Morpholino
MO1-hif1al
- ID
- ZDB-MRPHLNO-100610-11
- Name
- MO1-hif1al
- Previous Names
-
- hif3a-MO (1)
- MO2-hif1al
- Target
- Sequence
-
5' - CCTTTTCGACGTAGAGTTCACCATC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-hif1al
No data available
Phenotype
Phenotype resulting from MO1-hif1al
No data available
Phenotype of all Fish created by or utilizing MO1-hif1al
1 - 3 of 3
Citations
- Lin, T.Y., Chou, C.F., Chung, H.Y., Chiang, C.Y., Li, C.H., Wu, J.L., Lin, H.J., Pai, T.W., Hu, C.H., Tzou, W.S. (2014) Hypoxia-Inducible Factor 2 Alpha Is Essential for Hepatic Outgrowth and Functions via the Regulation of leg1 Transcription in the Zebrafish Embryo. PLoS One. 9:e101980
- Zhang, P., Yao, Q., Lu, L., Li, Y., Chen, P.J., Duan, C. (2014) Hypoxia-inducible factor 3 is an oxygen-dependent transcription activator and regulates a distinct transcriptional response to hypoxia. Cell Reports. 6:1110-21
- Ko, C.Y., Tsai, M.Y., Tseng, W.F., Cheng, C.H., Huang, C.R., Wu, J.S., Chung, H.Y., Hsieh, C.S., Sun, C.K., Hwang, S.P., Yuh, C.H., Huang, C.J., Pai, T.W., Tzou, W.S., and Hu, C.H. (2011) Integration of CNS survival and differentiation by HIF2α. Cell death and differentiation. 18(11):1757-70
- Hsieh, C.S., Ko, C.Y., Chen, S.Y., Liu, T.M., Wu, J.S., Hu, C.H., and Sun, C.K. (2008) In vivo long-term continuous observation of gene expression in zebrafish embryo nerve systems by using harmonic generation microscopy and morphant technology. Journal of Biomedical Optics. 13(6):064041
1 - 4 of 4
Show