Morpholino

MO1-naca

ID
ZDB-MRPHLNO-100608-1
Name
MO1-naca
Previous Names
  • E3I3-MO (1)
Target
Sequence
5' - AACAGAAAGAGAGATACCCGTGTCG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This MO targets the exon 3/intron 3 boundary of an isoform of naca (sknac).
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-naca
Expressed Gene Anatomy Figures
myhz2 Fig. 9 from Li et al., 2009
myod1 Fig. 4 from Li et al., 2009
myog Fig. 4 from Li et al., 2009
smyhc1 Fig. 9 from Li et al., 2009
Phenotype
Phenotype resulting from MO1-naca
Phenotype Fish Figures
fast muscle cell myofibril disorganized, abnormal WT + MO1-naca Fig. 6 from Li et al., 2009
fast muscle cell sarcomere decreased amount, abnormal WT + MO1-naca Fig. 6 from Li et al., 2009
heart edematous, abnormal WT + MO1-naca Fig. 4 from Li et al., 2009
locomotion decreased occurrence, abnormal WT + MO1-naca Fig. 4 from Li et al., 2009
muscle contraction decreased occurrence, abnormal WT + MO1-naca Fig. 4 from Li et al., 2009
muscle thin filament assembly disrupted, abnormal WT + MO1-naca Fig. 5,  Fig. 6 from Li et al., 2009
slow muscle cell myofibril disorganized, abnormal WT + MO1-naca Fig. 5 from Li et al., 2009
striated muscle myosin thick filament assembly disrupted, abnormal WT + MO1-naca Fig. 5,  Fig. 6 from Li et al., 2009
whole organism dead, abnormal WT + MO1-naca text only from Li et al., 2009
whole organism paralysed, abnormal WT + MO1-naca Fig. 4 from Li et al., 2009
Phenotype of all Fish created by or utilizing MO1-naca
Phenotype Fish Conditions Figures
whole organism paralysed, abnormal WT + MO1-naca standard conditions Fig. 4 from Li et al., 2009
fast muscle cell sarcomere decreased amount, abnormal WT + MO1-naca standard conditions Fig. 6 from Li et al., 2009
muscle contraction decreased occurrence, abnormal WT + MO1-naca standard conditions Fig. 4 from Li et al., 2009
whole organism dead, abnormal WT + MO1-naca standard conditions text only from Li et al., 2009
muscle thin filament assembly disrupted, abnormal WT + MO1-naca standard conditions Fig. 5,  Fig. 6 from Li et al., 2009
locomotion decreased occurrence, abnormal WT + MO1-naca standard conditions Fig. 4 from Li et al., 2009
striated muscle myosin thick filament assembly disrupted, abnormal WT + MO1-naca standard conditions Fig. 5,  Fig. 6 from Li et al., 2009
slow muscle cell myofibril disorganized, abnormal WT + MO1-naca standard conditions Fig. 5 from Li et al., 2009
fast muscle cell myofibril disorganized, abnormal WT + MO1-naca standard conditions Fig. 6 from Li et al., 2009
heart edematous, abnormal WT + MO1-naca standard conditions Fig. 4 from Li et al., 2009
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.