Morpholino

MO2-plxnd1

ID
ZDB-MRPHLNO-100521-6
Name
MO2-plxnd1
Previous Names
  • plxnD1 3207-3462 (1)
Target
Sequence
5' - CACACACACTCACGTTGATGATGAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-plxnd1
No data available
Phenotype
Phenotype resulting from MO2-plxnd1
Phenotype Fish Figures
blood circulation process quality, abnormal y1Tg + MO2-plxnd1 Fig. 2 from Torres-Vazquez et al., 2004
blood vessel remodeling disrupted, abnormal WT + MO2-plxnd1 text only from Torres-Vazquez et al., 2004
branching involved in blood vessel morphogenesis disrupted, abnormal y1Tg + MO2-plxnd1 Fig. 2 from Torres-Vazquez et al., 2004
caudal vein morphology, abnormal WT + MO2-plxnd1 text only from Torres-Vazquez et al., 2004
common cardinal vein increased width, abnormal s843Tg + MO2-plxnd1 Fig. 7 with image from Hamm et al., 2016
facial lymphatic network lymphatic endothelial cluster DsRed expression increased amount, abnormal nz150Tg/nz150Tg; y7Tg/y7Tg + MO2-plxnd1 Fig. 4 with image from Britto et al., 2022
facial lymphatic network lymphatic endothelial cluster ab9-mapk labeling increased amount, abnormal nz101Tg/nz101Tg; y7Tg/y7Tg + MO2-plxnd1 Fig. 5 with image from Britto et al., 2022
facial lymphatic vessel DsRed expression spatial pattern, abnormal nz101Tg/nz101Tg; s843Tg/s843Tg + MO2-plxnd1 Fig. 1 with image from Britto et al., 2022
intersegmental vessel increased branchiness, abnormal y1Tg + MO2-plxnd1 Fig. 2 from Torres-Vazquez et al., 2004
intersegmental vessel morphology, abnormal y1Tg + MO2-plxnd1 Fig. 2 from Torres-Vazquez et al., 2004
intersegmental vessel EGFP expression spatial pattern, abnormal nz101Tg/nz101Tg; s843Tg/s843Tg + MO2-plxnd1 Fig. 1 with image from Britto et al., 2022
intersegmental vessel spatial pattern, abnormal y1Tg + MO2-plxnd1 Fig. 2 from Torres-Vazquez et al., 2004
sprouting angiogenesis disrupted, abnormal y1Tg + MO2-plxnd1 Fig. 2 from Torres-Vazquez et al., 2004
trunk lymph vasculature misaligned with trunk intersegmental vessel, abnormal nz101Tg/nz101Tg; s843Tg/s843Tg + MO2-plxnd1 Fig. 1 with image from Britto et al., 2022
trunk lymphatic system DsRed expression spatial pattern, abnormal nz101Tg/nz101Tg; s843Tg/s843Tg + MO2-plxnd1 Fig. 1 with image from Britto et al., 2022
trunk vasculature lymphatic endothelial cluster ab9-mapk labeling increased amount, abnormal nz101Tg/nz101Tg; y7Tg/y7Tg + MO2-plxnd1 Fig. 5 with image from Britto et al., 2022
trunk vasculature sprouting angiogenesis increased occurrence, abnormal y1Tg + MO2-plxnd1 Figure 6. with image from Carretero-Ortega et al., 2019
venous blood vessel morphogenesis decreased process quality, abnormal mu240Tg + MO2-plxnd1 Fig. 7 with image from Hamm et al., 2016
Phenotype of all Fish created by or utilizing MO2-plxnd1
Phenotype Fish Conditions Figures
blood vessel remodeling disrupted, abnormal WT + MO2-plxnd1 standard conditions text only from Torres-Vazquez et al., 2004
caudal vein morphology, abnormal WT + MO2-plxnd1 standard conditions text only from Torres-Vazquez et al., 2004
venous blood vessel morphogenesis decreased process quality, abnormal mu240Tg + MO2-plxnd1 standard conditions Fig. 7 with image from Hamm et al., 2016
common cardinal vein increased width, abnormal mu240Tg + MO2-plxnd1 standard conditions Fig. 7 with image from Hamm et al., 2016
venous blood vessel morphogenesis decreased process quality, abnormal s843Tg + MO2-plxnd1 standard conditions Fig. 7 with image from Hamm et al., 2016
common cardinal vein increased width, abnormal s843Tg + MO2-plxnd1 standard conditions Fig. 7 with image from Hamm et al., 2016
sprouting angiogenesis disrupted, abnormal y1Tg + MO2-plxnd1 standard conditions Fig. 2 from Torres-Vazquez et al., 2004
intersegmental vessel morphology, abnormal y1Tg + MO2-plxnd1 standard conditions Fig. 2 from Torres-Vazquez et al., 2004
intersegmental vessel spatial pattern, abnormal y1Tg + MO2-plxnd1 standard conditions Fig. 2 from Torres-Vazquez et al., 2004
intersegmental vessel increased branchiness, abnormal y1Tg + MO2-plxnd1 standard conditions Fig. 2 from Torres-Vazquez et al., 2004
blood circulation process quality, abnormal y1Tg + MO2-plxnd1 standard conditions Fig. 2 from Torres-Vazquez et al., 2004
branching involved in blood vessel morphogenesis disrupted, abnormal y1Tg + MO2-plxnd1 standard conditions Fig. 2 from Torres-Vazquez et al., 2004
trunk vasculature sprouting angiogenesis increased occurrence, abnormal y1Tg + MO2-plxnd1 control Figure 6. with image from Carretero-Ortega et al., 2019
trunk lymph vasculature misaligned with trunk intersegmental vessel, abnormal nz101Tg/nz101Tg; s843Tg/s843Tg + MO2-plxnd1 standard conditions Fig. 1 with image from Britto et al., 2022
trunk lymphatic system DsRed expression spatial pattern, abnormal nz101Tg/nz101Tg; s843Tg/s843Tg + MO2-plxnd1 standard conditions Fig. 1 with image from Britto et al., 2022
intersegmental vessel EGFP expression spatial pattern, abnormal nz101Tg/nz101Tg; s843Tg/s843Tg + MO2-plxnd1 standard conditions Fig. 1 with image from Britto et al., 2022
facial lymphatic vessel DsRed expression spatial pattern, abnormal nz101Tg/nz101Tg; s843Tg/s843Tg + MO2-plxnd1 standard conditions Fig. 1 with image from Britto et al., 2022
trunk vasculature lymphatic endothelial cluster ab9-mapk labeling increased amount, abnormal nz101Tg/nz101Tg; y7Tg/y7Tg + MO2-plxnd1 standard conditions Fig. 5 with image from Britto et al., 2022
facial lymphatic network lymphatic endothelial cluster ab9-mapk labeling increased amount, abnormal nz101Tg/nz101Tg; y7Tg/y7Tg + MO2-plxnd1 standard conditions Fig. 5 with image from Britto et al., 2022
facial lymphatic network lymphatic endothelial cluster DsRed expression increased amount, abnormal nz150Tg/nz150Tg; y7Tg/y7Tg + MO2-plxnd1 standard conditions Fig. 4 with image from Britto et al., 2022
trunk vasculature sprouting angiogenesis increased occurrence, abnormal gipc1skt1/skt1; gipc2skt4/skt4; y1Tg + MO2-plxnd1 control Figure 6. with image from Carretero-Ortega et al., 2019
Citations