Morpholino
MO2-foxg1a
- ID
- ZDB-MRPHLNO-100514-2
- Name
- MO2-foxg1a
- Previous Names
- None
- Target
- Sequence
-
5' - CTTTTCTTTCTCCCATATCCAACAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-foxg1a
No data available
Phenotype
Phenotype resulting from MO2-foxg1a
No data available
Phenotype of all Fish created by or utilizing MO2-foxg1a
No data available
Citations
- Carlin, D., Sepich, D., Grover, V.K., Cooper, M.K., Solnica-Krezel, L., and Inbal, A. (2012) Six3 cooperates with Hedgehog signaling to specify ventral telencephalon by promoting early expression of Foxg1a and repressing Wnt signaling. Development (Cambridge, England). 139(14):2614-2624
- Danesin, C., Peres, J.N., Johansson, M., Snowden, V., Cording, A., Papalopulu, N., and Houart, C. (2009) Integration of telencephalic Wnt and hedgehog signaling center activities by Foxg1. Developmental Cell. 16(4):576-587
- Picker, A., Cavodeassi, F., Machate, A., Bernauer, S., Hans, S., Abe, G., Kawakami, K., Wilson, S.W., and Brand, M. (2009) Dynamic coupling of pattern formation and morphogenesis in the developing vertebrate retina. PLoS Biology. 7(10):e1000214
1 - 3 of 3
Show