Morpholino
MO1-hspb1
- ID
- ZDB-MRPHLNO-100512-4
- Name
- MO1-hspb1
- Previous Names
- None
- Target
- Sequence
-
5' - GTTTTGAAGAGTTGTTTTTCGGCTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation blocking MO, targets the 5'UTR.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-hspb1
No data available
Phenotype
Phenotype resulting from MO1-hspb1
1 - 5 of 13 Show all
Phenotype of all Fish created by or utilizing MO1-hspb1
1 - 5 of 17 Show all
Citations
- Gonzaga-Jauregui, C., Harel, T., Gambin, T., Kousi, M., Griffin, L.B., Francescatto, L., Ozes, B., Karaca, E., Jhangiani, S.N., Bainbridge, M.N., Lawson, K.S., Pehlivan, D., Okamoto, Y., Withers, M., Mancias, P., Slavotinek, A., Reitnauer, P.J., Goksungur, M.T., Shy, M., Crawford, T.O., Koenig, M., Willer, J., Flores, B.N., Pediaditrakis, I., Us, O., Wiszniewski, W., Parman, Y., Antonellis, A., Muzny, D.M., Baylor-Hopkins Center for Mendelian Genomics, Katsanis, N., Battaloglu, E., Boerwinkle, E., Gibbs, R.A., Lupski, J.R. (2015) Exome Sequence Analysis Suggests that Genetic Burden Contributes to Phenotypic Variability and Complex Neuropathy. Cell Reports. 12(7):1169-83
- Middleton, R.C., and Shelden, E.A. (2013) Small heat shock protein HSPB1 regulates growth of embryonic zebrafish craniofacial muscles. Experimental cell research. 319(6):860-874
- Tucker, N.R., Ustyugov, A., Bryantsev, A.L., Konkel, M.E., and Shelden, E.A. (2009) Hsp27 is persistently expressed in zebrafish skeletal and cardiac muscle tissues but dispensable for their morphogenesis. Cell stress & chaperones. 14(5):521-533
1 - 3 of 3
Show