Morpholino

MO1-clint1a

ID

ZDB-MRPHLNO-100510-11

Name

MO1-clint1a

Previous Names

clint1-atg MO (1)
MO1-clint1

Target

clint1a (1)

Sequence

5' - CCGCACTTTCCACATATTCAACATC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-clint1a

No data available

Phenotype

Phenotype resulting from MO1-clint1a

Phenotype	Fish	Figures
epidermis cell population proliferation increased occurrence, abnormal	zf106Tg + MO1-clint1a	Fig. 3, Fig. 6 from Phatak et al., 2018
head epidermal cell morphology, abnormal	zf106Tg + MO1-clint1a	Fig. 1, Fig. 7 from Phatak et al., 2018
peridermal cell decreased size, abnormal	zf106Tg + MO1-clint1a	Fig. 3, Fig. 5 from Phatak et al., 2018
peridermal cell cell population proliferation increased occurrence, abnormal	zf106Tg + MO1-clint1a	Fig. 3, Fig. 6 from Phatak et al., 2018
peridermal cell endocytosis increased occurrence, abnormal	zf106Tg + MO1-clint1a	Fig. 2, Fig. 4 from Phatak et al., 2018
peridermal cell lysosome increased amount, abnormal	zf106Tg + MO1-clint1a	Fig. 2 from Phatak et al., 2018
peridermal cell perinucleolar compartment ab1-cav1 labeling increased amount, abnormal	zf106Tg + MO1-clint1a	Fig. 2 from Phatak et al., 2018
peridermal cell perinucleolar compartment EGFP expression increased amount, abnormal	zf106Tg + MO1-clint1a	Fig. 1, Fig. 2 from Phatak et al., 2018
trunk epidermal cell morphology, abnormal	WT + MO1-clint1a	Fig. 1, Fig. 7 from Phatak et al., 2018

Phenotype of all Fish created by or utilizing MO1-clint1a

Phenotype	Fish	Conditions	Figures
head epidermal cell morphology, abnormal	WT + MO1-clint1a	standard conditions	Fig. 1 from Phatak et al., 2018
trunk epidermal cell morphology, abnormal	WT + MO1-clint1a	standard conditions	Fig. 1 from Phatak et al., 2018
peridermal cell decreased size, abnormal	zf106Tg + MO1-clint1a	control	Fig. 3, Fig. 5 from Phatak et al., 2018
epidermis cell population proliferation occurrence, ameliorated	zf106Tg + MO1-clint1a	chemical treatment: dynasore	Fig. 6 from Phatak et al., 2018
peridermal cell cell population proliferation increased occurrence, abnormal	zf106Tg + MO1-clint1a	standard conditions	Fig. 3, Fig. 6 from Phatak et al., 2018
peridermal cell perinucleolar compartment ab1-cav1 labeling increased amount, abnormal	zf106Tg + MO1-clint1a	standard conditions	Fig. 2 from Phatak et al., 2018
peridermal cell cell population proliferation occurrence, ameliorated	zf106Tg + MO1-clint1a	chemical treatment: dynasore	Fig. 6 from Phatak et al., 2018
peridermal cell lysosome increased amount, abnormal	zf106Tg + MO1-clint1a	standard conditions	Fig. 2 from Phatak et al., 2018
head epidermal cell morphology, ameliorated	zf106Tg + MO1-clint1a	chemical treatment: dynasore	Fig. 7 from Phatak et al., 2018
trunk epidermal cell morphology, ameliorated	zf106Tg + MO1-clint1a	chemical treatment: dynasore	Fig. 7 from Phatak et al., 2018
peridermal cell perinucleolar compartment EGFP expression increased amount, abnormal	zf106Tg + MO1-clint1a	standard conditions	Fig. 1, Fig. 2 from Phatak et al., 2018
peridermal cell size, ameliorated	zf106Tg + MO1-clint1a	chemical treatment: dynasore	Fig. 5 from Phatak et al., 2018
peridermal cell endocytosis occurrence, ameliorated	zf106Tg + MO1-clint1a	chemical treatment: dynasore	Fig. 4 from Phatak et al., 2018
peridermal cell endocytosis increased occurrence, abnormal	zf106Tg + MO1-clint1a	control	Fig. 2, Fig. 4 from Phatak et al., 2018
epidermis cell population proliferation increased occurrence, abnormal	zf106Tg + MO1-clint1a	standard conditions	Fig. 3, Fig. 6 from Phatak et al., 2018
trunk epidermal cell morphology, abnormal	zf106Tg + MO1-clint1a	control	Fig. 7 from Phatak et al., 2018
head epidermal cell morphology, abnormal	zf106Tg + MO1-clint1a	control	Fig. 7 from Phatak et al., 2018

Citations