Morpholino
MO1-pak1
- ID
- ZDB-MRPHLNO-100507-1
- Name
- MO1-pak1
- Previous Names
- None
- Target
- Sequence
-
5' - CCTCTACTTCCCCATTGTCTGACAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-pak1
No data available
Phenotype
Phenotype resulting from MO1-pak1
1 - 5 of 14 Show all
Phenotype of all Fish created by or utilizing MO1-pak1
1 - 5 of 14 Show all
Citations
- Lu, X., Zhang, Y., Liu, F., Wang, L. (2020) Rac2 Regulates the Migration of T Lymphoid Progenitors to the Thymus during Zebrafish Embryogenesis. Journal of immunology (Baltimore, Md. : 1950). 204(9):2447-2454
- Jagadeeshan, S., Sagayaraj, R.V., Paneerselvan, N., Ghouse, S.S., Malathi, R. (2017) Toxicity and anti-angiogenicity evaluation of Pak1 inhibitor IPA-3 using zebrafish embryo model. Cell biology and toxicology. 33(1):41-56
- Magini, P., Pippucci, T., Tsai, I.C., Coppola, S., Stellacci, E., Bartoletti-Stella, A., Turchetti, D., Graziano, C., Cenacchi, G., Neri, I., Cordelli, D.M., Marchiani, V., Bergamaschi, R., Gasparre, G., Neri, G., Mazzanti, L., Patrizi, A., Franzoni, E., Romeo, G., Bordo, D., Tartaglia, M., Katsanis, N., Seri, M. (2014) A mutation in PAK3 with a dual molecular effect deregulates the RAS/MAPK pathway and drives an X-linked syndromic phenotype. Human molecular genetics. 23(13):3607-17
- Zou, J., Li, W.Q., Li, Q., Li, X.Q., Zhang, J.T., Liu, G.Q., Chen, J., Qiu, X.X., Tian, F.J., Wang, Z.Z., Zhu, N., Qin, Y.W., Shen, B., Liu, T.X., and Jing, Q. (2011) Two Functional MicroRNA-126s Repress a Novel Target Gene p21-Activated Kinase 1 to Regulate Vascular Integrity in Zebrafish. Circulation research. 108(2):201-209
- Lightcap, C.M., Kari, G., Arias-Romero, L.E., Chernoff, J., Rodeck, U., and Williams, J.C. (2009) Interaction with LC8 is required for Pak1 nuclear import and is indispensable for zebrafish development. PLoS One. 4(6):e6025
1 - 5 of 5
Show