Morpholino

MO1-pak1

ID

ZDB-MRPHLNO-100507-1

Name

MO1-pak1

Previous Names

None

Target

pak1 (1)

Sequence

5' - CCTCTACTTCCCCATTGTCTGACAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-pak1

Expressed Gene	Anatomy	Figures
ccr9a	thymus pro-T cell	Fig. 5 from Lu et al., 2020
foxn1	thymus epithelial cell	Fig. 5 from Lu et al., 2020
lck	thymus pro-T cell	Fig. 5 from Lu et al., 2020
rag1	thymus pro-T cell	Fig. 5 from Lu et al., 2020

Phenotype

Phenotype resulting from MO1-pak1

Phenotype	Fish	Figures
ceratohyal cartilage kinked, abnormal	WT + MO1-pak1	Fig. S5 from Magini et al., 2014
convergent extension process quality, abnormal	WT + MO1-pak1	Fig. 4 from Magini et al., 2014
cranial cartilage malformed, abnormal	WT + MO1-pak1	Fig. S5 from Magini et al., 2014
eye decreased size, abnormal	WT + MO1-pak1	Fig. 4 from Lightcap et al., 2009
head decreased size, abnormal	WT + MO1-pak1	Fig. 4 from Lightcap et al., 2009
heart edematous, abnormal	WT + MO1-pak1	Fig. 4 from Lightcap et al., 2009
heart morphology, abnormal	WT + MO1-pak1	Fig. 4 from Lightcap et al., 2009
post-vent region curved, abnormal	WT + MO1-pak1	Fig. 4 from Lightcap et al., 2009
thymus epithelial cell foxn1 expression amount, ameliorated	WT + MO1-pak1	Fig. 5 from Lu et al., 2020
thymus pro-T cell ccr9a expression decreased amount, abnormal	WT + MO1-pak1	Fig. 5 from Lu et al., 2020
thymus pro-T cell rag1 expression decreased amount, abnormal	WT + MO1-pak1	Fig. 5 from Lu et al., 2020
thymus pro-T cell lck expression decreased amount, abnormal	WT + MO1-pak1	Fig. 5 from Lu et al., 2020
thymus T cell decreased amount, abnormal	WT + MO1-pak1	Fig. 5 from Lu et al., 2020
whole organism decreased length, abnormal	WT + MO1-pak1	Fig. 4 from Lightcap et al., 2009
whole organism semi-lethal (sensu genetics), abnormal	WT + MO1-pak1	Fig. 4 from Lightcap et al., 2009

Phenotype of all Fish created by or utilizing MO1-pak1

Phenotype	Fish	Conditions	Figures
convergent extension process quality, abnormal	WT + MO1-pak1	standard conditions	Fig. 4 from Magini et al., 2014
thymus pro-T cell rag1 expression decreased amount, abnormal	WT + MO1-pak1	standard conditions	Fig. 5 from Lu et al., 2020
post-vent region curved, abnormal	WT + MO1-pak1	standard conditions	Fig. 4 from Lightcap et al., 2009
ceratohyal cartilage kinked, abnormal	WT + MO1-pak1	standard conditions	Fig. S5 from Magini et al., 2014
head decreased size, abnormal	WT + MO1-pak1	standard conditions	Fig. 4 from Lightcap et al., 2009
thymus T cell decreased amount, abnormal	WT + MO1-pak1	standard conditions	Fig. 5 from Lu et al., 2020
cranial cartilage malformed, abnormal	WT + MO1-pak1	standard conditions	Fig. S5 from Magini et al., 2014
thymus pro-T cell lck expression decreased amount, abnormal	WT + MO1-pak1	standard conditions	Fig. 5 from Lu et al., 2020
whole organism decreased length, abnormal	WT + MO1-pak1	standard conditions	Fig. 4 from Lightcap et al., 2009
heart edematous, abnormal	WT + MO1-pak1	standard conditions	Fig. 4 from Lightcap et al., 2009
thymus pro-T cell ccr9a expression decreased amount, abnormal	WT + MO1-pak1	standard conditions	Fig. 5 from Lu et al., 2020
eye decreased size, abnormal	WT + MO1-pak1	standard conditions	Fig. 4 from Lightcap et al., 2009
thymus epithelial cell foxn1 expression amount, ameliorated	WT + MO1-pak1	standard conditions	Fig. 5 from Lu et al., 2020
whole organism semi-lethal (sensu genetics), abnormal	WT + MO1-pak1	standard conditions	Fig. 4 from Lightcap et al., 2009
heart morphology, abnormal	WT + MO1-pak1	standard conditions	Fig. 4 from Lightcap et al., 2009

Citations