Morpholino

MO1-pak1

ID
ZDB-MRPHLNO-100507-1
Name
MO1-pak1
Previous Names
None
Target
Sequence
5' - CCTCTACTTCCCCATTGTCTGACAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-pak1
Phenotype
Phenotype resulting from MO1-pak1
Phenotype of all Fish created by or utilizing MO1-pak1
Phenotype Fish Conditions Figures
convergent extension process quality, abnormal WT + MO1-pak1 standard conditions Fig. 4 from Magini et al., 2014
thymus pro-T cell rag1 expression decreased amount, abnormal WT + MO1-pak1 standard conditions Fig. 5 from Lu et al., 2020
post-vent region curved, abnormal WT + MO1-pak1 standard conditions Fig. 4 with image from Lightcap et al., 2009
ceratohyal cartilage kinked, abnormal WT + MO1-pak1 standard conditions Fig. S5 from Magini et al., 2014
head decreased size, abnormal WT + MO1-pak1 standard conditions Fig. 4 with image from Lightcap et al., 2009
thymus T cell decreased amount, abnormal WT + MO1-pak1 standard conditions Fig. 5 from Lu et al., 2020
cranial cartilage malformed, abnormal WT + MO1-pak1 standard conditions Fig. S5 from Magini et al., 2014
thymus pro-T cell lck expression decreased amount, abnormal WT + MO1-pak1 standard conditions Fig. 5 from Lu et al., 2020
whole organism decreased length, abnormal WT + MO1-pak1 standard conditions Fig. 4 with image from Lightcap et al., 2009
heart edematous, abnormal WT + MO1-pak1 standard conditions Fig. 4 with image from Lightcap et al., 2009
thymus pro-T cell ccr9a expression decreased amount, abnormal WT + MO1-pak1 standard conditions Fig. 5 from Lu et al., 2020
eye decreased size, abnormal WT + MO1-pak1 standard conditions Fig. 4 with image from Lightcap et al., 2009
thymus epithelial cell foxn1 expression amount, ameliorated WT + MO1-pak1 standard conditions Fig. 5 from Lu et al., 2020
whole organism semi-lethal (sensu genetics), abnormal WT + MO1-pak1 standard conditions Fig. 4 with image from Lightcap et al., 2009
heart morphology, abnormal WT + MO1-pak1 standard conditions Fig. 4 with image from Lightcap et al., 2009
Citations