Morpholino

MO1-mkxa

ID
ZDB-MRPHLNO-100506-4
Name
MO1-mkxa
Previous Names
  • Irxl1-MOI (1)
Target
Sequence
5' - GTGTTCATCTTTGGTATATTAGTCC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
translation-blocker
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mkxa
No data available
Phenotype
Phenotype resulting from MO1-mkxa
Phenotype Fish Figures
brain malformed, abnormal WT + MO1-mkxa + MO4-tp53 Fig. 5 with image from Chuang et al., 2010
brain morphogenesis process quality, abnormal WT + MO1-mkxa + MO4-tp53 Fig. 5 with image from Chuang et al., 2010
cephalic musculature decreased amount, abnormal WT + MO1-mkxa + MO4-tp53 Fig. 9 with image from Chuang et al., 2010
ceratobranchial cartilage decreased amount, abnormal WT + MO1-mkxa + MO4-tp53 Fig. 8 with image from Chuang et al., 2010
ceratobranchial cartilage malformed, abnormal WT + MO1-mkxa + MO4-tp53 Fig. 8 with image from Chuang et al., 2010
ceratohyal cartilage malformed, abnormal WT + MO1-mkxa + MO4-tp53 Fig. 8 with image from Chuang et al., 2010
embryonic viscerocranium morphogenesis process quality, abnormal WT + MO1-mkxa + MO4-tp53 Fig. 6 with imageFig. 8 with image from Chuang et al., 2010
extraocular musculature decreased amount, abnormal WT + MO1-mkxa + MO4-tp53 Fig. 6 with image from Chuang et al., 2010
Meckel's cartilage decreased size, abnormal WT + MO1-mkxa + MO4-tp53 Fig. 8 with image from Chuang et al., 2010
neural crest physical object quality, abnormal WT + MO1-mkxa + MO4-tp53 Fig. 7 with image from Chuang et al., 2010
palatoquadrate cartilage decreased size, abnormal WT + MO1-mkxa + MO4-tp53 Fig. 8 with image from Chuang et al., 2010
pharyngeal arch cartilage physical object quality, abnormal WT + MO1-mkxa + MO4-tp53 Fig. 6 with image from Chuang et al., 2010
pharyngeal musculature decreased amount, abnormal WT + MO1-mkxa + MO4-tp53 Fig. 6 with image from Chuang et al., 2010
pharyngeal pouch disorganized, abnormal WT + MO1-mkxa + MO4-tp53 Fig. 6 with image from Chuang et al., 2010
skeletal muscle cell irregular spatial pattern, abnormal AB + MO1-mkxa + MO4-tp53 Fig. 1Fig. 11 from Chuang et al., 2014
somite actin filament decondensed, abnormal AB + MO1-mkxa + MO4-tp53 Fig. 1 from Chuang et al., 2014
somite actin filament disorganized, abnormal AB + MO1-mkxa + MO4-tp53 Fig. 1 from Chuang et al., 2014
somite focal adhesion decreased amount, abnormal AB + MO1-mkxa + MO4-tp53 Fig. 1 from Chuang et al., 2014
thigmotaxis disrupted, abnormal AB + MO1-mkxa + MO4-tp53 Fig. 1 from Chuang et al., 2014
ventricular system malformed, abnormal WT + MO1-mkxa + MO4-tp53 Fig. 5 with image from Chuang et al., 2010
whole organism curved, abnormal WT + MO1-mkxa + MO4-tp53 Fig. 1Fig. 11 from Chuang et al., 2014
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-mkxa + MO4-tp53 Fig. 1Fig. 11 from Chuang et al., 2014
Phenotype of all Fish created by or utilizing MO1-mkxa
Phenotype Fish Conditions Figures
somite focal adhesion decreased amount, abnormal AB + MO1-mkxa + MO4-tp53 standard conditions Fig. 1 from Chuang et al., 2014
skeletal muscle cell irregular spatial pattern, abnormal AB + MO1-mkxa + MO4-tp53 standard conditions Fig. 1 from Chuang et al., 2014
whole organism curved, abnormal AB + MO1-mkxa + MO4-tp53 standard conditions Fig. 1 from Chuang et al., 2014
somite actin filament disorganized, abnormal AB + MO1-mkxa + MO4-tp53 standard conditions Fig. 1 from Chuang et al., 2014
thigmotaxis disrupted, abnormal AB + MO1-mkxa + MO4-tp53 standard conditions Fig. 1 from Chuang et al., 2014
whole organism anterior-posterior axis decreased length, abnormal AB + MO1-mkxa + MO4-tp53 standard conditions Fig. 1 from Chuang et al., 2014
somite actin filament decondensed, abnormal AB + MO1-mkxa + MO4-tp53 standard conditions Fig. 1 from Chuang et al., 2014
neural crest physical object quality, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 7 with image from Chuang et al., 2010
pharyngeal pouch disorganized, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 6 with image from Chuang et al., 2010
extraocular musculature decreased amount, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 6 with image from Chuang et al., 2010
ceratobranchial cartilage malformed, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 8 with image from Chuang et al., 2010
skeletal muscle cell irregular spatial pattern, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 11 from Chuang et al., 2014
Meckel's cartilage decreased size, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 8 with image from Chuang et al., 2010
brain morphogenesis process quality, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 5 with image from Chuang et al., 2010
whole organism curved, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 11 from Chuang et al., 2014
ceratohyal cartilage malformed, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 8 with image from Chuang et al., 2010
ventricular system malformed, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 5 with image from Chuang et al., 2010
pharyngeal musculature decreased amount, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 6 with image from Chuang et al., 2010
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 11 from Chuang et al., 2014
embryonic viscerocranium morphogenesis process quality, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 6 with imageFig. 8 with image from Chuang et al., 2010
ceratobranchial cartilage decreased amount, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 8 with image from Chuang et al., 2010
pharyngeal arch cartilage physical object quality, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 6 with image from Chuang et al., 2010
brain malformed, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 5 with image from Chuang et al., 2010
palatoquadrate cartilage decreased size, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 8 with image from Chuang et al., 2010
cephalic musculature decreased amount, abnormal WT + MO1-mkxa + MO4-tp53 standard conditions Fig. 9 with image from Chuang et al., 2010
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-mkxa + MO4-tp53 + MO6-myod1 standard conditions Fig. 11 from Chuang et al., 2014
post-vent region deformed, abnormal WT + MO1-mkxa + MO4-tp53 + MO6-myod1 standard conditions Fig. 11 from Chuang et al., 2014
whole organism curved, abnormal WT + MO1-mkxa + MO4-tp53 + MO6-myod1 standard conditions Fig. 11 from Chuang et al., 2014
skeletal muscle cell morphology, abnormal WT + MO1-mkxa + MO4-tp53 + MO6-myod1 standard conditions Fig. 11 from Chuang et al., 2014
Citations