Morpholino
MO2-rbp4l
- ID
 - ZDB-MRPHLNO-100503-17
 - Name
 - MO2-rbp4l
 - Previous Names
 - 
    
        
    
    
        
        
- purpurin MO2 (1)
 
 - Target
 - Sequence
 - 
    
        
        
    
        
            
                5' - TTAGATTCACAGCCTACCCGAAAAG - 3'
                
            
            
                
 - Disclaimer
 - Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
 - Note
 - None
 - Genome Resources
 - None
 
                
                    
                        Target Location
                    
                    
                
                
            
        
        
    
        
            
            
    
        
    
    
    
        
        
    
    
    
                
                    
                        Genomic Features
                    
                    
                
                
            
        
        
    
        
            
            
    
    
        
    
No data available
    
        
        
    
    
    
                
                    
                        Expression
                    
                    
                
                
            
        
        
    
        
            
            
    
    
                
                    
                        Gene expression in Wild Types + MO2-rbp4l
                    
                    
                
                
            
        
        
    
        
            
                
    
    
        
    
No data available
    
            
        
    
    
    
                
                    
                        Phenotype
                    
                    
                
                
            
        
        
    
        
            
            
    
    
                
                    
                        Phenotype resulting from MO2-rbp4l
                    
                    
                
                
            
        
        
    
        
            
                
    
        
    | Phenotype | Fish | Figures | 
|---|---|---|
| eye decreased size, abnormal | WT + MO2-rbp4l | 
                
                    
                        text only
                    
                    from Nagashima et al., 2009 | 
        
| retina layer formation disrupted, abnormal | WT + MO2-rbp4l | 
                
                    
                        text only
                    
                    from Nagashima et al., 2009 | 
        
                
                    
                        Phenotype of all Fish created by or utilizing MO2-rbp4l
                    
                    
                
                
            
        
        
    
        
            
                
    
        
    | Phenotype | Fish | Conditions | Figures | 
|---|---|---|---|
| eye decreased size, abnormal | WT + MO2-rbp4l | standard conditions | 
                
                    
                        text only
                    
                    from Nagashima et al., 2009 | 
        
| retina layer formation disrupted, abnormal | WT + MO2-rbp4l | standard conditions | 
                
                    
                        text only
                    
                    from Nagashima et al., 2009 | 
        
                
                    
                        Citations