Morpholino

MO1-gak

ID

ZDB-MRPHLNO-100429-2

Name

MO1-gak

Previous Names

Target

Sequence

5' - GGACAGAAGCCTCTGCACACAAATA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-gak

Expressed Gene	Anatomy	Figures
egr2b	rhombomere 3 rhombomere 5	Fig. 9 from Bai et al., 2010
elavl3	axis cell basal plate midbrain region diencephalon midbrain hindbrain boundary rhombomere	Fig. 10 from Bai et al., 2010
fgf8a	forebrain midbrain hindbrain boundary optic stalk somite tail bud	Fig. 9 from Bai et al., 2010
her4.1	hindbrain midbrain neural rod telencephalon	Fig. 10 from Bai et al., 2010
shha	diencephalon floor plate forebrain midbrain boundary	Fig. 9 from Bai et al., 2010

Phenotype

Phenotype resulting from MO1-gak

Phenotype	Fish	Figures
apoptotic process increased occurrence, abnormal	AB + MO1-gak	Fig. 8 from Bai et al., 2010
blood circulation decreased rate, abnormal	WT + MO1-gak	Fig. 7 from Bai et al., 2010
brain degenerate, abnormal	WT + MO1-gak	Fig. 7 from Bai et al., 2010
brain cell degenerate, abnormal	WT + MO1-gak	Fig. 7 from Bai et al., 2010
extension decreased thickness, abnormal	WT + MO1-gak	Fig. 7 from Bai et al., 2010
eye cell degenerate, abnormal	WT + MO1-gak	Fig. 7 from Bai et al., 2010
hindbrain increased size, abnormal	WT + MO1-gak	Fig. 7 from Bai et al., 2010
tectal ventricle increased size, abnormal	WT + MO1-gak	Fig. 7 from Bai et al., 2010

Phenotype of all Fish created by or utilizing MO1-gak

Phenotype	Fish	Conditions	Figures
apoptotic process increased occurrence, abnormal	AB + MO1-gak	standard conditions	Fig. 8 from Bai et al., 2010
blood circulation decreased rate, abnormal	WT + MO1-gak	standard conditions	Fig. 7 from Bai et al., 2010
brain degenerate, abnormal	WT + MO1-gak	standard conditions	Fig. 7 from Bai et al., 2010
brain cell degenerate, abnormal	WT + MO1-gak	standard conditions	Fig. 7 from Bai et al., 2010
extension decreased thickness, abnormal	WT + MO1-gak	standard conditions	Fig. 7 from Bai et al., 2010
tectal ventricle increased size, abnormal	WT + MO1-gak	standard conditions	Fig. 7 from Bai et al., 2010
eye cell degenerate, abnormal	WT + MO1-gak	standard conditions	Fig. 7 from Bai et al., 2010
hindbrain increased size, abnormal	WT + MO1-gak	standard conditions	Fig. 7 from Bai et al., 2010

Citations