Morpholino

MO1-f2

ID
ZDB-MRPHLNO-100428-7
Name
MO1-f2
Previous Names
None
Target
Sequence
5' - GTTTGGCTCCCATCCTTGAGAGTGA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-f2
Phenotype
Phenotype resulting from MO1-f2
Phenotype Fish Figures
endoderm phlda3 expression increased amount, abnormal WT + MO1-f2 Fig. 5 from Day et al., 2009
extension decreased size, abnormal WT + MO1-f2 Fig. 1 from Day et al., 2009
forebrain phlda3 expression increased amount, abnormal WT + MO1-f2 Fig. 5 from Day et al., 2009
midbrain phlda3 expression increased amount, abnormal WT + MO1-f2 Fig. 5 from Day et al., 2009
midbrain hindbrain boundary sox21a expression decreased amount, abnormal WT + MO1-f2 Fig. 5 from Day et al., 2009
midbrain hindbrain boundary constriction absent, abnormal WT + MO1-f2 Fig. 5 from Day et al., 2009
midbrain-hindbrain boundary development disrupted, abnormal WT + MO1-f2 Fig. 5 from Day et al., 2009
pharyngeal arch 3-7 phlda3 expression increased amount, abnormal WT + MO1-f2 Fig. 5 from Day et al., 2009
post-vent region morphology, abnormal WT + MO1-f2 Fig. 1 from Day et al., 2009
tail bud phlda3 expression mislocalised, abnormal WT + MO1-f2 Fig. 5 from Day et al., 2009
trunk morphology, abnormal WT + MO1-f2 Fig. 1 from Day et al., 2009
whole organism rbp4 expression decreased amount, abnormal WT + MO1-f2 Fig. 3 from Day et al., 2009
whole organism hbbe1.1 expression decreased amount, abnormal WT + MO1-f2 Fig. 3 from Day et al., 2009
whole organism col1a2 expression decreased amount, abnormal WT + MO1-f2 Fig. 3 from Day et al., 2009
whole organism sox21a expression decreased amount, abnormal WT + MO1-f2 Fig. 4 from Day et al., 2009
whole organism sox21b expression decreased amount, abnormal WT + MO1-f2 Fig. 4 from Day et al., 2009
whole organism tnni2a.1 expression decreased amount, abnormal WT + MO1-f2 Fig. 3 from Day et al., 2009
whole organism cldne expression increased amount, abnormal WT + MO1-f2 Fig. 3 from Day et al., 2009
whole organism mdm2 expression increased amount, abnormal WT + MO1-f2 Fig. 3 from Day et al., 2009
whole organism gatd3l expression increased amount, abnormal WT + MO1-f2 Fig. 3 from Day et al., 2009
whole organism anxa1a expression increased amount, abnormal WT + MO1-f2 Fig. 3 from Day et al., 2009
whole organism phlda3 expression increased amount, abnormal WT + MO1-f2 Fig. 3Fig. 4 from Day et al., 2009
Phenotype of all Fish created by or utilizing MO1-f2
Phenotype Fish Conditions Figures
whole organism mdm2 expression increased amount, abnormal WT + MO1-f2 standard conditions Fig. 3 from Day et al., 2009
pharyngeal arch 3-7 phlda3 expression increased amount, abnormal WT + MO1-f2 standard conditions Fig. 5 from Day et al., 2009
whole organism sox21b expression decreased amount, abnormal WT + MO1-f2 standard conditions Fig. 4 from Day et al., 2009
endoderm phlda3 expression increased amount, abnormal WT + MO1-f2 standard conditions Fig. 5 from Day et al., 2009
whole organism phlda3 expression increased amount, abnormal WT + MO1-f2 standard conditions Fig. 3Fig. 4 from Day et al., 2009
trunk morphology, abnormal WT + MO1-f2 standard conditions Fig. 1 from Day et al., 2009
midbrain-hindbrain boundary development disrupted, abnormal WT + MO1-f2 standard conditions Fig. 5 from Day et al., 2009
whole organism hbbe1.1 expression decreased amount, abnormal WT + MO1-f2 standard conditions Fig. 3 from Day et al., 2009
whole organism gatd3l expression increased amount, abnormal WT + MO1-f2 standard conditions Fig. 3 from Day et al., 2009
whole organism cldne expression increased amount, abnormal WT + MO1-f2 standard conditions Fig. 3 from Day et al., 2009
whole organism anxa1a expression increased amount, abnormal WT + MO1-f2 standard conditions Fig. 3 from Day et al., 2009
tail bud phlda3 expression mislocalised, abnormal WT + MO1-f2 standard conditions Fig. 5 from Day et al., 2009
whole organism rbp4 expression decreased amount, abnormal WT + MO1-f2 standard conditions Fig. 3 from Day et al., 2009
whole organism tnni2a.1 expression decreased amount, abnormal WT + MO1-f2 standard conditions Fig. 3 from Day et al., 2009
midbrain hindbrain boundary constriction absent, abnormal WT + MO1-f2 standard conditions Fig. 5 from Day et al., 2009
midbrain phlda3 expression increased amount, abnormal WT + MO1-f2 standard conditions Fig. 5 from Day et al., 2009
extension decreased size, abnormal WT + MO1-f2 standard conditions Fig. 1 from Day et al., 2009
whole organism sox21a expression decreased amount, abnormal WT + MO1-f2 standard conditions Fig. 4 from Day et al., 2009
forebrain phlda3 expression increased amount, abnormal WT + MO1-f2 standard conditions Fig. 5 from Day et al., 2009
whole organism col1a2 expression decreased amount, abnormal WT + MO1-f2 standard conditions Fig. 3 from Day et al., 2009
post-vent region morphology, abnormal WT + MO1-f2 standard conditions Fig. 1 from Day et al., 2009
midbrain hindbrain boundary sox21a expression decreased amount, abnormal WT + MO1-f2 standard conditions Fig. 5 from Day et al., 2009
blood coagulation disrupted, abnormal la2Tg + MO1-f2 physical alteration: posterior cardinal vein Fig. 1 from Tournoij et al., 2010
Citations