Morpholino

MO1-ncor1

ID
ZDB-MRPHLNO-100419-8
Name
MO1-ncor1
Previous Names
  • n-cor MO1 (1)
Target
Sequence
5' - GACATGCTGTGACCTTTTGCTGGCC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation blocking
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ncor1
Expressed Gene Anatomy Figures
aldh1a2 Fig. 2 with image from Xu et al., 2009
cyp26a1 Fig. 2 with image from Xu et al., 2009
egr2b Fig. 4 with image from Xu et al., 2009
en2a Fig. 4 with image from Xu et al., 2009
etsrp Fig. 5 with image from Li et al., 2014
fli1 Fig. 2 with image from Li et al., 2014
gata1a Fig. 2 with image from Li et al., 2014
hoxb1b Fig. 3 with image from Xu et al., 2009
hoxb4a Fig. 4 with image from Xu et al., 2009
lmo2 Fig. 5 with image from Li et al., 2014
mafba Fig. 5 with image from Xu et al., 2009
mfap4.1 Fig. 1 with image,  Fig. 3 with image from Li et al., 2014
mpx Fig. 1 with image,  Fig. 3 with image,  Fig. 7 with image from Li et al., 2014
myod1 Fig. 5 with image from Xu et al., 2009
otx2b Fig. 3 with image from Xu et al., 2009
spi1b Fig. 4 with image from Li et al., 2014
tal1 Fig. 5 with image from Li et al., 2014
Phenotype
Phenotype resulting from MO1-ncor1
Phenotype Fish Figures
anterior/posterior pattern specification disrupted, abnormal WT + MO1-ncor1 Fig. 4 with image,  Fig. 5 with image from Xu et al., 2009
apoptotic process increased process quality, abnormal WT + MO1-ncor1 Fig. 3 with image from Li et al., 2014
hindbrain decreased length, abnormal WT + MO1-ncor1 Fig. 4 with image,  Fig. 5 with image from Xu et al., 2009
hindbrain development disrupted, abnormal WT + MO1-ncor1 Fig. 4 with image,  Fig. 5 with image from Xu et al., 2009
macrophage decreased amount, abnormal WT + MO1-ncor1 Fig. 3 with image from Li et al., 2014
neutrophil decreased amount, abnormal WT + MO1-ncor1 Fig. 1 with image,  Fig. 3 with image,  Fig. 7 with image from Li et al., 2014
whole organism wholly posteriorized, abnormal WT + MO1-ncor1 Fig. 3 with image from Xu et al., 2009
Phenotype of all Fish created by or utilizing MO1-ncor1
Phenotype Fish Conditions Figures
whole organism wholly posteriorized, abnormal WT + MO1-ncor1 standard conditions Fig. 3 with image from Xu et al., 2009
hindbrain decreased length, abnormal WT + MO1-ncor1 standard conditions Fig. 4 with image,  Fig. 5 with image from Xu et al., 2009
hindbrain development disrupted, abnormal WT + MO1-ncor1 standard conditions Fig. 4 with image,  Fig. 5 with image from Xu et al., 2009
anterior/posterior pattern specification disrupted, abnormal WT + MO1-ncor1 standard conditions Fig. 4 with image,  Fig. 5 with image from Xu et al., 2009
neutrophil decreased amount, abnormal WT + MO1-ncor1 standard conditions Fig. 1 with image,  Fig. 3 with image,  Fig. 7 with image from Li et al., 2014
macrophage decreased amount, abnormal WT + MO1-ncor1 standard conditions Fig. 3 with image from Li et al., 2014
apoptotic process increased process quality, abnormal WT + MO1-ncor1 standard conditions Fig. 3 with image from Li et al., 2014
macrophage decreased amount, abnormal WT + MO1-ncor1 + MO4-tp53 standard conditions Fig. 3 with image from Li et al., 2014
neutrophil decreased amount, abnormal WT + MO1-ncor1 + MO4-tp53 standard conditions Fig. 3 with image from Li et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.