Morpholino
MO2-llgl1
- ID
- ZDB-MRPHLNO-100419-13
- Name
- MO2-llgl1
- Previous Names
-
- MOlgl1-utr (1)
- Target
- Sequence
-
5' - TGAAGCCGAATCAGAGGTAAATCAC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Targets the 5'UTR
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-llgl1
No data available
Phenotype
Phenotype resulting from MO2-llgl1
1 - 4 of 4
Phenotype of all Fish created by or utilizing MO2-llgl1
1 - 5 of 5
Citations
- Raman, R., Damle, I., Rote, R., Banerjee, S., Dingare, C., Sonawane, M. (2016) aPKC regulates apical localization of Lgl to restrict elongation of microridges in developing zebrafish epidermis. Nature communications. 7:11643
- Clark, B.S., Cui, S., Miesfeld, J.B., Klezovitch, O., Vasioukhin, V., and Link, B.A. (2012) Loss of Llgl1 in retinal neuroepithelia reveals links between apical domain size, Notch activity and neurogenesis. Development (Cambridge, England). 139(9):1599-1610
- Hava, D., Forster, U., Matsuda, M., Cui, S., Link, B.A., Eichhorst, J., Wiesner, B., Chitnis, A., and Abdelilah-Seyfried, S. (2009) Apical membrane maturation and cellular rosette formation during morphogenesis of the zebrafish lateral line. Journal of Cell Science. 122(Pt 5):687-695
1 - 3 of 3
Show