Morpholino
MO3-llgl2
- ID
- ZDB-MRPHLNO-100419-11
- Name
- MO3-llgl2
- Previous Names
-
- MOlgl2-utrb (1)
- Target
- Sequence
-
5' - AGCCGGGACTCAAACTGCCCTCTCT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Targets 5'UTR
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-llgl2
No data available
Phenotype
Phenotype resulting from MO3-llgl2
Phenotype | Fish | Figures |
---|---|---|
brain hydrocephalic, abnormal | AB/TU + MO3-llgl2 |
Fig. 1 ![]() |
post-vent region curved ventral, abnormal | AB/TU + MO3-llgl2 |
Fig. 1 ![]() |
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO3-llgl2
1 - 3 of 3
Citations
- Kujawski, S., Sonawane, M., Knust, E. (2019) penner/lgl2 is required for the integrity of the photoreceptor layer in the zebrafish retina. Biology Open. 8(4):
- Tay, H.G., Schulze, S.K., Compagnon, J., Foley, F.C., Heisenberg, C.P., Yost, H.J., Abdelilah-Seyfried, S., and Amack, J.D. (2013) Lethal giant larvae 2 regulates development of the ciliated organ Kupffer's vesicle. Development (Cambridge, England). 140(7):1550-1559
- Hava, D., Forster, U., Matsuda, M., Cui, S., Link, B.A., Eichhorst, J., Wiesner, B., Chitnis, A., and Abdelilah-Seyfried, S. (2009) Apical membrane maturation and cellular rosette formation during morphogenesis of the zebrafish lateral line. Journal of Cell Science. 122(Pt 5):687-695
1 - 3 of 3
Show