Morpholino

MO2-pcdh19

ID
ZDB-MRPHLNO-100406-2
Name
MO2-pcdh19
Previous Names
  • 19Mo-S1 (1)
Target
Sequence
5' - AATTGTCTGGGTACCTGCAGTTGTA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice blocking.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-pcdh19
Expressed Gene Anatomy Figures
pcdh19 Fig. 4 with image from Emond et al., 2009
Phenotype
Phenotype resulting from MO2-pcdh19
Phenotype Fish Figures
brain disorganized, abnormal WT + MO2-pcdh19 Fig. 6 with image from Emond et al., 2009
brain morphogenesis disrupted, abnormal WT + MO2-pcdh19 Fig. 4 with image from Emond et al., 2009
convergent extension disrupted, abnormal WT + MO2-pcdh19 Fig. 6 with image,  Fig. 7 with image,  Fig. 10 with image from Emond et al., 2009
ethmoid cartilage decreased size, abnormal WT + MO2-pcdh19 Fig. S5 with image from Melvin et al., 2013
forebrain condensed, abnormal WT + MO2-pcdh19 Fig. 4 with image from Emond et al., 2009
hindbrain disorganized, abnormal WT + MO2-pcdh19 Fig. 4 with image from Emond et al., 2009
midbrain hindbrain boundary morphology, abnormal WT + MO2-pcdh19 Fig. 4 with image from Emond et al., 2009
neural keel increased width, abnormal WT + MO2-pcdh19 Fig. 6 with image,  Fig. 7 with image from Emond et al., 2009
neural rod collapsed, abnormal WT + MO2-pcdh19 Fig. 6 with image from Emond et al., 2009
neural rod disorganized, abnormal WT + MO2-pcdh19 Fig. 6 with image from Emond et al., 2009
neural rod increased width, abnormal WT + MO2-pcdh19 Fig. 6 with image from Emond et al., 2009
neural rod Y-shaped, abnormal WT + MO2-pcdh19 Fig. 6 with image from Emond et al., 2009
neurocranial trabecula fused with neurocranial trabecula, abnormal WT + MO2-pcdh19 Fig. S5 with image from Melvin et al., 2013
optic vesicle malformed, abnormal WT + MO2-pcdh19 Fig. 6 with image from Emond et al., 2009
ventricular system epithelium morphology, abnormal WT + MO2-pcdh19 Fig. 9 with image from Emond et al., 2009
whole organism decreased length, abnormal WT + MO2-pcdh19 Fig. 6 with image from Emond et al., 2009
Phenotype of all Fish created by or utilizing MO2-pcdh19
Phenotype Fish Conditions Figures
whole organism decreased length, abnormal WT + MO2-pcdh19 standard conditions Fig. 6 with image from Emond et al., 2009
neural rod increased width, abnormal WT + MO2-pcdh19 standard conditions Fig. 6 with image from Emond et al., 2009
hindbrain disorganized, abnormal WT + MO2-pcdh19 standard conditions Fig. 4 with image from Emond et al., 2009
forebrain condensed, abnormal WT + MO2-pcdh19 standard conditions Fig. 4 with image from Emond et al., 2009
neural rod disorganized, abnormal WT + MO2-pcdh19 standard conditions Fig. 6 with image from Emond et al., 2009
midbrain hindbrain boundary morphology, abnormal WT + MO2-pcdh19 standard conditions Fig. 4 with image from Emond et al., 2009
neural keel increased width, abnormal WT + MO2-pcdh19 standard conditions Fig. 6 with image,  Fig. 7 with image from Emond et al., 2009
convergent extension disrupted, abnormal WT + MO2-pcdh19 standard conditions Fig. 6 with image,  Fig. 7 with image from Emond et al., 2009
neural rod Y-shaped, abnormal WT + MO2-pcdh19 standard conditions Fig. 6 with image from Emond et al., 2009
optic vesicle malformed, abnormal WT + MO2-pcdh19 standard conditions Fig. 6 with image from Emond et al., 2009
ethmoid cartilage decreased size, abnormal WT + MO2-pcdh19 standard conditions Fig. S5 with image from Melvin et al., 2013
neurocranial trabecula fused with neurocranial trabecula, abnormal WT + MO2-pcdh19 standard conditions Fig. S5 with image from Melvin et al., 2013
ventricular system epithelium morphology, abnormal WT + MO2-pcdh19 standard conditions Fig. 9 with image from Emond et al., 2009
brain morphogenesis disrupted, abnormal WT + MO2-pcdh19 standard conditions Fig. 4 with image from Emond et al., 2009
neural rod collapsed, abnormal WT + MO2-pcdh19 standard conditions Fig. 6 with image from Emond et al., 2009
brain disorganized, abnormal WT + MO2-pcdh19 standard conditions Fig. 6 with image from Emond et al., 2009
convergent extension disrupted, abnormal kca66Tg; kca6Tg + MO2-pcdh19 standard conditions Fig. 10 with image from Emond et al., 2009
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.