Morpholino

MO2-pcdh19

ID
ZDB-MRPHLNO-100406-2
Name
MO2-pcdh19
Previous Names
  • 19Mo-S1 (1)
Target
Sequence
5' - AATTGTCTGGGTACCTGCAGTTGTA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice blocking.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-pcdh19
No data available
Phenotype
Phenotype resulting from MO2-pcdh19
Phenotype of all Fish created by or utilizing MO2-pcdh19
Phenotype Fish Conditions Figures
whole organism decreased length, abnormal WT + MO2-pcdh19 standard conditions Fig. 6 with image from Emond et al., 2009
neural rod increased width, abnormal WT + MO2-pcdh19 standard conditions Fig. 6 with image from Emond et al., 2009
hindbrain disorganized, abnormal WT + MO2-pcdh19 standard conditions Fig. 4 with image from Emond et al., 2009
forebrain condensed, abnormal WT + MO2-pcdh19 standard conditions Fig. 4 with image from Emond et al., 2009
neural rod disorganized, abnormal WT + MO2-pcdh19 standard conditions Fig. 6 with image from Emond et al., 2009
midbrain hindbrain boundary morphology, abnormal WT + MO2-pcdh19 standard conditions Fig. 4 with image from Emond et al., 2009
convergent extension disrupted, abnormal WT + MO2-pcdh19 standard conditions Fig. 6 with imageFig. 7 with image from Emond et al., 2009
neural keel increased width, abnormal WT + MO2-pcdh19 standard conditions Fig. 6 with imageFig. 7 with image from Emond et al., 2009
neural rod Y-shaped, abnormal WT + MO2-pcdh19 standard conditions Fig. 6 with image from Emond et al., 2009
optic vesicle malformed, abnormal WT + MO2-pcdh19 standard conditions Fig. 6 with image from Emond et al., 2009
ethmoid cartilage decreased size, abnormal WT + MO2-pcdh19 standard conditions Fig. S5 with image from Melvin et al., 2013
neurocranial trabecula fused with neurocranial trabecula, abnormal WT + MO2-pcdh19 standard conditions Fig. S5 with image from Melvin et al., 2013
ventricular system epithelium morphology, abnormal WT + MO2-pcdh19 standard conditions Fig. 9 with image from Emond et al., 2009
brain morphogenesis disrupted, abnormal WT + MO2-pcdh19 standard conditions Fig. 4 with image from Emond et al., 2009
neural rod collapsed, abnormal WT + MO2-pcdh19 standard conditions Fig. 6 with image from Emond et al., 2009
brain disorganized, abnormal WT + MO2-pcdh19 standard conditions Fig. 6 with image from Emond et al., 2009
convergent extension disrupted, abnormal kca66Tg; kca6Tg + MO2-pcdh19 standard conditions Fig. 10 with image from Emond et al., 2009
Citations