Morpholino
MO2-gnptab
- ID
- ZDB-MRPHLNO-100302-2
- Name
- MO2-gnptab
- Previous Names
- None
- Target
- Sequence
-
5' - AAACATTTGTAGAGCCAACCTGGT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-gnptab
No data available
Phenotype
Phenotype resulting from MO2-gnptab
1 - 5 of 44 Show all
Phenotype of all Fish created by or utilizing MO2-gnptab
1 - 5 of 59 Show all
Citations
- Lu, P.N., Moreland, T., Christian, C.J., Lund, T.C., Steet, R.A., Flanagan-Steet, H. (2020) Inappropriate cathepsin K secretion promotes its enzymatic activation driving heart and valve malformation. JCI insight. 5(20):
- Qian, Y., van Meel, E., Flanagan-Steet, H., Yox, A., Steet, R., Kornfeld, S. (2015) Analysis of Mucolipidosis II/III GNPTAB Missense Mutations Identifies Domains of UDP-GlcNAc:Lysosomal Enzyme GlcNAc-1-Phosphotransferase Involved in Catalytic Function and Lysosomal Enzyme Recognition. The Journal of biological chemistry. 290(5):3045-56
- Qian, Y., Flanagan-Steet, H., van Meel, E., Steet, R., and Kornfeld, S.A. (2013) The DMAP interaction domain of UDP-GlcNAc:lysosomal enzyme N-acetylglucosamine-1-phosphotransferase is a substrate recognition module. Proceedings of the National Academy of Sciences of the United States of America. 110(25):10246-10251
- Petrey, A.C., Flanagan-Steet, H., Johnson, S., Fan, X., De la Rosa, M., Haskins, M.E., Nairn, A.V., Moremen, K.W., and Steet, R. (2012) Excessive activity of cathepsin K is associated with the cartilage defects in a zebrafish model for mucolipidosis II. Disease models & mechanisms. 5(2):177-190
- Flanagan-Steet, H., Sias, C., and Steet, R. (2009) Altered Chondrocyte Differentiation and Extracellular Matrix Homeostasis in a Zebrafish Model for Mucolipidosis II. The American journal of pathology. 175(5):2063-2075
1 - 5 of 5
Show