Morpholino

MO1-poc1b

ID
ZDB-MRPHLNO-100210-1
Name
MO1-poc1b
Previous Names
  • Drpoc1ATG (1)
  • MO1-wdr51b (1)
Target
Sequence
5' - GATCCTCCATTACAGACGCCATGAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-poc1b
No data available
Phenotype
Phenotype resulting from MO1-poc1b
Phenotype Fish Figures
cilium assembly process quality, abnormal AB/TU + MO1-poc1b Fig. 5 from Beck et al., 2014
eye decreased size, abnormal AB/TU + MO1-poc1b Fig. 5 from Beck et al., 2014
Fig. 4Fig. S4 from Roosing et al., 2014
Fig. 7 from Pearson et al., 2009
head decreased size, abnormal AB/TU + MO1-poc1b Fig. 5 from Beck et al., 2014
heart edematous, abnormal WT + MO1-poc1b Fig. 7 from Pearson et al., 2009
heart mislocalised laterally, abnormal WT + MO1-poc1b Fig. 7 from Pearson et al., 2009
heart looping disrupted, abnormal WT + MO1-poc1b Fig. 7 from Pearson et al., 2009
kidney cystic, abnormal AB/TU + MO1-poc1b Fig. 5 from Beck et al., 2014
Kupffer's vesicle cilium decreased length, abnormal WT + MO1-poc1b Fig. 7 from Pearson et al., 2009
melanocyte mislocalised, abnormal WT + MO1-poc1b Fig. 7 from Pearson et al., 2009
melanocyte spatial pattern, abnormal AB/TU + MO1-poc1b Fig. 5 from Beck et al., 2014
optokinetic behavior decreased process quality, abnormal WT + MO1-poc1b Fig. 4 from Roosing et al., 2014
palatoquadrate arch decreased length, abnormal WT + MO1-poc1b Fig. 7 from Pearson et al., 2009
palatoquadrate arch malformed, abnormal WT + MO1-poc1b Fig. 7 from Pearson et al., 2009
pericardium edematous, abnormal WT + MO1-poc1b Fig. 5 from Beck et al., 2014
Fig. S4 from Roosing et al., 2014
pharyngeal arch aplastic, abnormal WT + MO1-poc1b Fig. 7 from Pearson et al., 2009
photoreceptor cell photoreceptor outer segment aplastic/hypoplastic, abnormal WT + MO1-poc1b Fig. 4 from Roosing et al., 2014
pigment cell mislocalised, abnormal WT + MO1-poc1b Fig. S4 from Roosing et al., 2014
posterior neural tube cilium disorganized, abnormal WT + MO1-poc1b Fig. 7 from Pearson et al., 2009
posterior neural tube cilium distended, abnormal WT + MO1-poc1b Fig. 7 from Pearson et al., 2009
pronephric duct cilium disorganized, abnormal WT + MO1-poc1b Fig. 7 from Pearson et al., 2009
pronephros cystic, abnormal AB/TU + MO1-poc1b Fig. 5 from Beck et al., 2014
Fig. 7 from Pearson et al., 2009
retina cell death increased occurrence, abnormal AB/TU + MO1-poc1b Fig. 5 from Beck et al., 2014
retina photoreceptor connecting cilium decreased amount, abnormal AB/TU + MO1-poc1b Fig. 5 from Beck et al., 2014
retina photoreceptor connecting cilium decreased length, abnormal AB/TU + MO1-poc1b Fig. 5 from Beck et al., 2014
retinal cone cell decreased length, abnormal AB/TU + MO1-poc1b Fig. 5 from Beck et al., 2014
retinal cone cell photoreceptor outer segment aplastic/hypoplastic, abnormal AB/TU + MO1-poc1b Fig. 5 from Beck et al., 2014
retinal inner nuclear layer cell death increased occurrence, abnormal AB/TU + MO1-poc1b Fig. 5 from Beck et al., 2014
swim bladder uninflated, abnormal AB/TU + MO1-poc1b Fig. 5 from Beck et al., 2014
ventral mandibular arch decreased length, abnormal WT + MO1-poc1b Fig. 7 from Pearson et al., 2009
ventral mandibular arch malformed, abnormal WT + MO1-poc1b Fig. 7 from Pearson et al., 2009
whole organism curved, abnormal WT + MO1-poc1b Fig. S4 from Roosing et al., 2014
Fig. 7 from Pearson et al., 2009
whole organism decreased length, abnormal WT + MO1-poc1b Fig. 7 from Pearson et al., 2009
whole organism shortened, abnormal WT + MO1-poc1b Fig. S4 from Roosing et al., 2014
whole organism viability, abnormal AB/TU + MO1-poc1b Fig. 5 from Beck et al., 2014
whole organism anterior-posterior axis curved ventral, abnormal AB/TU + MO1-poc1b Fig. 5 from Beck et al., 2014
whole organism anterior-posterior axis decreased length, abnormal AB/TU + MO1-poc1b Fig. 5 from Beck et al., 2014
Phenotype of all Fish created by or utilizing MO1-poc1b
Phenotype Fish Conditions Figures
pronephros cystic, abnormal AB/TU + MO1-poc1b standard conditions Fig. 5 from Beck et al., 2014
retina photoreceptor connecting cilium decreased amount, abnormal AB/TU + MO1-poc1b standard conditions Fig. 5 from Beck et al., 2014
pericardium edematous, abnormal AB/TU + MO1-poc1b standard conditions Fig. 5 from Beck et al., 2014
melanocyte spatial pattern, abnormal AB/TU + MO1-poc1b standard conditions Fig. 5 from Beck et al., 2014
retinal cone cell photoreceptor outer segment aplastic/hypoplastic, abnormal AB/TU + MO1-poc1b standard conditions Fig. 5 from Beck et al., 2014
whole organism anterior-posterior axis decreased length, abnormal AB/TU + MO1-poc1b standard conditions Fig. 5 from Beck et al., 2014
head decreased size, abnormal AB/TU + MO1-poc1b standard conditions Fig. 5 from Beck et al., 2014
kidney cystic, abnormal AB/TU + MO1-poc1b standard conditions Fig. 5 from Beck et al., 2014
whole organism anterior-posterior axis curved ventral, abnormal AB/TU + MO1-poc1b standard conditions Fig. 5 from Beck et al., 2014
whole organism viability, abnormal AB/TU + MO1-poc1b standard conditions Fig. 5 from Beck et al., 2014
swim bladder uninflated, abnormal AB/TU + MO1-poc1b standard conditions Fig. 5 from Beck et al., 2014
retinal cone cell decreased length, abnormal AB/TU + MO1-poc1b standard conditions Fig. 5 from Beck et al., 2014
eye decreased size, abnormal AB/TU + MO1-poc1b standard conditions Fig. 5 from Beck et al., 2014
cilium assembly process quality, abnormal AB/TU + MO1-poc1b standard conditions Fig. 5 from Beck et al., 2014
retina cell death increased occurrence, abnormal AB/TU + MO1-poc1b standard conditions Fig. 5 from Beck et al., 2014
retinal inner nuclear layer cell death increased occurrence, abnormal AB/TU + MO1-poc1b standard conditions Fig. 5 from Beck et al., 2014
retina photoreceptor connecting cilium decreased length, abnormal AB/TU + MO1-poc1b standard conditions Fig. 5 from Beck et al., 2014
whole organism decreased length, abnormal WT + MO1-poc1b standard conditions Fig. 7 from Pearson et al., 2009
whole organism shortened, abnormal WT + MO1-poc1b standard conditions Fig. S4 from Roosing et al., 2014
pronephric duct cilium disorganized, abnormal WT + MO1-poc1b standard conditions Fig. 7 from Pearson et al., 2009
ventral mandibular arch decreased length, abnormal WT + MO1-poc1b standard conditions Fig. 7 from Pearson et al., 2009
heart mislocalised laterally, abnormal WT + MO1-poc1b standard conditions Fig. 7 from Pearson et al., 2009
pericardium edematous, abnormal WT + MO1-poc1b standard conditions Fig. S4 from Roosing et al., 2014
heart looping disrupted, abnormal WT + MO1-poc1b standard conditions Fig. 7 from Pearson et al., 2009
posterior neural tube cilium disorganized, abnormal WT + MO1-poc1b standard conditions Fig. 7 from Pearson et al., 2009
palatoquadrate arch decreased length, abnormal WT + MO1-poc1b standard conditions Fig. 7 from Pearson et al., 2009
ventral mandibular arch malformed, abnormal WT + MO1-poc1b standard conditions Fig. 7 from Pearson et al., 2009
melanocyte mislocalised, abnormal WT + MO1-poc1b standard conditions Fig. 7 from Pearson et al., 2009
pharyngeal arch aplastic, abnormal WT + MO1-poc1b standard conditions Fig. 7 from Pearson et al., 2009
whole organism curved, abnormal WT + MO1-poc1b standard conditions Fig. S4 from Roosing et al., 2014
Fig. 7 from Pearson et al., 2009
pigment cell mislocalised, abnormal WT + MO1-poc1b standard conditions Fig. S4 from Roosing et al., 2014
Kupffer's vesicle cilium decreased length, abnormal WT + MO1-poc1b standard conditions Fig. 7 from Pearson et al., 2009
eye decreased size, abnormal WT + MO1-poc1b standard conditions Fig. 4Fig. S4 from Roosing et al., 2014
Fig. 7 from Pearson et al., 2009
photoreceptor cell photoreceptor outer segment aplastic/hypoplastic, abnormal WT + MO1-poc1b standard conditions Fig. 4 from Roosing et al., 2014
pronephros cystic, abnormal WT + MO1-poc1b standard conditions Fig. 7 from Pearson et al., 2009
heart edematous, abnormal WT + MO1-poc1b standard conditions Fig. 7 from Pearson et al., 2009
posterior neural tube cilium distended, abnormal WT + MO1-poc1b standard conditions Fig. 7 from Pearson et al., 2009
optokinetic behavior decreased process quality, abnormal WT + MO1-poc1b standard conditions Fig. 4 from Roosing et al., 2014
palatoquadrate arch malformed, abnormal WT + MO1-poc1b standard conditions Fig. 7 from Pearson et al., 2009
Citations