Morpholino
MO5-mef2ca
- ID
- ZDB-MRPHLNO-091230-1
- Name
- MO5-mef2ca
- Previous Names
- None
- Target
- Sequence
-
5' - CCTTCCTCTTCCAAAAGTACAGTCC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-mef2ca
No data available
Phenotype
Phenotype resulting from MO5-mef2ca
Phenotype | Fish | Figures |
---|---|---|
heart looping disrupted, abnormal | WT + MO5-mef2ca |
Fig. 6
from Ghosh et al., 2009 |
pericardium edematous, abnormal | WT + MO5-mef2ca |
Fig. 6
from Ghosh et al., 2009 |
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO5-mef2ca
1 - 5 of 6 Show all
Citations
- Rawnsley, D.R., Xiao, J., Lee, J.S., Liu, X., Mericko-Ishizuka, P., Kumar, V., He, J., Basu, A., Lu, M., Lynn, F.C., Pack, M., Gasa, R., Kahn, M.L. (2013) The transcription factor Atonal homolog 8 regulates Gata4 and Friend of Gata-2 during vertebrate development. The Journal of biological chemistry. 288:24429-40
- Ghosh, T.K., Song, F.F., Packham, E.A., Buxton, S., Robinson, T.E., Ronksley, J., Self, T., Bonser, A.J., and Brook, J.D. (2009) Physical Interaction between TBX5 and MEF2C Is Required for Early Heart Development. Molecular and cellular biology. 29(8):2205-2218
1 - 2 of 2
Show