Morpholino

MO1-ier2a

ID

ZDB-MRPHLNO-091020-10

Name

MO1-ier2a

Previous Names

Target

Sequence

5' - GCCTCTGCTGTGACATCCATTGTTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-ier2a

Expressed Gene	Anatomy	Figures
sox32	endoderm forerunner cell group	Fig. 6 from Hong et al., 2009

Phenotype

Phenotype resulting from MO1-ier2a

Phenotype	Fish	Figures
convergent extension disrupted, abnormal	AB + MO1-ier2a	Fig. 2 from Hong et al., 2009
determination of left/right symmetry disrupted, abnormal	AB + MO1-ier2a	Fig. 4 from Hong et al., 2009
forerunner cell group disorganized, abnormal	AB + MO1-ier2a	Fig. 6 from Hong et al., 2009
Kupffer's vesicle cilium decreased amount, abnormal	AB + MO1-ier2a	Fig. 5 from Hong et al., 2009
notochord increased width, abnormal	AB + MO1-ier2a	Fig. 2 from Hong et al., 2009
notochord undulate, abnormal	AB + MO1-ier2a	Fig. 4 from Hong et al., 2009
somite increased width, abnormal	AB + MO1-ier2a	Fig. 2 from Hong et al., 2009
whole organism decreased length, abnormal	AB + MO1-ier2a	Fig. 2 , Fig. 3 from Hong et al., 2009

Phenotype of all Fish created by or utilizing MO1-ier2a

Phenotype	Fish	Conditions	Figures
notochord increased width, abnormal	AB + MO1-ier2a	standard conditions	Fig. 2 from Hong et al., 2009
forerunner cell group disorganized, abnormal	AB + MO1-ier2a	standard conditions	Fig. 6 from Hong et al., 2009
somite increased width, abnormal	AB + MO1-ier2a	standard conditions	Fig. 2 from Hong et al., 2009
convergent extension disrupted, abnormal	AB + MO1-ier2a	standard conditions	Fig. 2 from Hong et al., 2009
notochord undulate, abnormal	AB + MO1-ier2a	standard conditions	Fig. 4 from Hong et al., 2009
determination of left/right symmetry disrupted, abnormal	AB + MO1-ier2a	standard conditions	Fig. 4 from Hong et al., 2009
Kupffer's vesicle cilium decreased amount, abnormal	AB + MO1-ier2a	standard conditions	Fig. 5 from Hong et al., 2009
whole organism decreased length, abnormal	AB + MO1-ier2a	standard conditions	Fig. 2 , Fig. 3 from Hong et al., 2009
Kupffer's vesicle cilium decreased amount, abnormal	AB + MO1-fibpb + MO1-ier2a	standard conditions	Fig. 5 from Hong et al., 2009
whole organism decreased length, abnormal	AB + MO1-fibpb + MO1-ier2a	standard conditions	Fig. 3 from Hong et al., 2009
forerunner cell group disorganized, abnormal	AB + MO1-fibpb + MO1-ier2a	standard conditions	Fig. 6 from Hong et al., 2009
determination of left/right symmetry disrupted, abnormal	AB + MO1-fibpb + MO1-ier2a	standard conditions	Fig. 4 from Hong et al., 2009
notochord undulate, abnormal	AB + MO1-fibpb + MO1-ier2a	standard conditions	Fig. 4 from Hong et al., 2009

Citations