Morpholino

MO1-adgrg6

ID

ZDB-MRPHLNO-090917-8

Name

MO1-adgrg6

Previous Names

None

Target

Sequence

5' - ACAGAATATGAATACCTGATACTCC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-adgrg6

No data available

Phenotype

Phenotype resulting from MO1-adgrg6

Phenotype	Fish	Figures
cell migration involved in sprouting angiogenesis decreased process quality, abnormal	y1Tg + MO1-adgrg6	Fig. 4 from Cui et al., 2014
inner ear edematous, abnormal	AB + MO1-adgrg6	Fig. S4 from Patra et al., 2013
inner ear increased size, abnormal	WT + MO1-adgrg6	Fig. S4 from Patra et al., 2013 Fig. S3 from Monk et al., 2009
intersegmental vessel has fewer parts of type blood vessel endothelial cell, abnormal	y7Tg + MO1-adgrg6	Fig. 4 from Cui et al., 2014
intersegmental vessel morphology, abnormal	y1Tg + MO1-adgrg6	Fig. 4, Fig. 7 from Cui et al., 2014
myelination of posterior lateral line nerve axons disrupted, abnormal	AB + MO1-adgrg6	Fig. S4 from Patra et al., 2013
posterior lateral line nerve compact myelin absent, abnormal	WT + MO1-adgrg6	Fig. S3 from Monk et al., 2009
posterior lateral line nerve myelin sheath morphology, abnormal	WT + MO1-adgrg6	Fig. 1 from Monk et al., 2009
posterior lateral line nerve myelin sheath physical object quality, abnormal	AB + MO1-adgrg6	Fig. S4 from Patra et al., 2013
sprouting angiogenesis decreased process quality, abnormal	y1Tg + MO1-adgrg6	Fig. 4, Fig. 7 from Cui et al., 2014

Phenotype of all Fish created by or utilizing MO1-adgrg6

Phenotype	Fish	Conditions	Figures
myelination of posterior lateral line nerve axons disrupted, abnormal	AB + MO1-adgrg6	standard conditions	Fig. S4 from Patra et al., 2013
inner ear edematous, abnormal	AB + MO1-adgrg6	standard conditions	Fig. S4 from Patra et al., 2013
inner ear increased size, abnormal	AB + MO1-adgrg6	standard conditions	Fig. S4 from Patra et al., 2013
posterior lateral line nerve myelin sheath physical object quality, abnormal	AB + MO1-adgrg6	standard conditions	Fig. S4 from Patra et al., 2013
posterior lateral line nerve myelin sheath morphology, abnormal	WT + MO1-adgrg6	standard conditions	Fig. 1 from Monk et al., 2009
inner ear increased size, abnormal	WT + MO1-adgrg6	standard conditions	Fig. S3 from Monk et al., 2009
posterior lateral line nerve compact myelin absent, abnormal	WT + MO1-adgrg6	standard conditions	Fig. S3 from Monk et al., 2009
intersegmental vessel morphology, abnormal	y1Tg + MO1-adgrg6	standard conditions	Fig. 4, Fig. 7 from Cui et al., 2014
sprouting angiogenesis decreased process quality, abnormal	y1Tg + MO1-adgrg6	standard conditions	Fig. 4, Fig. 7 from Cui et al., 2014
cell migration involved in sprouting angiogenesis decreased process quality, abnormal	y1Tg + MO1-adgrg6	standard conditions	Fig. 4 from Cui et al., 2014
intersegmental vessel has fewer parts of type blood vessel endothelial cell, abnormal	y7Tg + MO1-adgrg6	standard conditions	Fig. 4 from Cui et al., 2014

Citations