Morpholino
MO1-adgrg6
- ID
- ZDB-MRPHLNO-090917-8
- Name
- MO1-adgrg6
- Previous Names
- None
- Target
- Sequence
-
5' - ACAGAATATGAATACCTGATACTCC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-adgrg6
No data available
Phenotype
Phenotype resulting from MO1-adgrg6
1 - 5 of 10 Show all
Phenotype of all Fish created by or utilizing MO1-adgrg6
1 - 5 of 11 Show all
Citations
- El-Hage, O., Mikdache, A., Boueid, M.J., Degerny, C., Tawk, M. (2025) Schwann cells have a limited window of time in which to initiate myelination signaling during early migration in vivo. Cells & development. 181:203993203993
- Cui, H., Wang, Y., Huang, H., Yu, W., Bai, M., Zhang, L., Bryan, B.A., Wang, Y., Luo, J., Li, D., Ma, Y., Liu, M. (2014) GPR126 Regulates Developmental and Pathological Angiogenesis through Modulation of VEGFR2 Signaling. The Journal of biological chemistry. 289(50):34871-85
- Patra, C., van Amerongen, M.J., Ghosh, S., Ricciardi, F., Sajjad, A., Novoyatleva, T., Mogha, A., Monk, K.R., Mühlfeld, C., and Engel, F.B. (2013) Organ-specific function of adhesion G protein-coupled receptor GPR126 is domain-dependent. Proceedings of the National Academy of Sciences of the United States of America. 110(42):16898-16903
- Monk, K.R., Naylor, S.G., Glenn, T.D., Mercurio, S., Perlin, J.R., Dominguez, C., Moens, C.B., and Talbot, W.S. (2009) A G protein-coupled receptor is essential for Schwann cells to initiate myelination. Science (New York, N.Y.). 325(5946):1402-1405
1 - 4 of 4
Show