Morpholino
MO1-eaf2
- ID
- ZDB-MRPHLNO-090820-6
- Name
- MO1-eaf2
- Previous Names
-
- Eaf2-MO1 (1)
- Target
- Sequence
-
5' - ATATGCTGTTCCATTCATTCTAATC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation blocking.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-eaf2
No data available
Phenotype
Phenotype resulting from MO1-eaf2
1 - 5 of 17 Show all
Phenotype of all Fish created by or utilizing MO1-eaf2
1 - 5 of 50 Show all
Citations
- Liu, J.X., Xu, Q.H., Li, S., Yu, X., Liu, W., Ouyang, G., Zhang, T., Chen, L.L. (2017) Transcriptional factors Eaf1/2 inhibit endoderm and mesoderm formation via suppressing TGF-β signaling. Biochimica et biophysica acta. 1860(10):1103-1116
- Liu, J.X., Zhang, D., Xie, X., Ouyang, G., Liu, X., Sun, Y., and Xiao, W. (2013) Eaf1 and Eaf2 negatively regulate canonical Wnt/β-catenin signaling. Development (Cambridge, England). 140(5):1067-1078
- Wan, X., Ji, W., Mei, X., Zhou, J., Liu, J.X., Fang, C., and Xiao, W. (2010) Negative Feedback Regulation of Wnt4 Signaling by EAF1 and EAF2/U19. PLoS One. 5(2):e9118
- Liu, J.X., Hu, B., Wang, Y., Gui, J.F., and Xiao, W. (2009) Zebrafish eaf1 and eaf2/u19 mediate effective convergence and extension movements through the maintenance of wnt11 and wnt5 expression. The Journal of biological chemistry. 284(24):16679-16692
1 - 4 of 4
Show