Morpholino
MO2-upf1
- ID
- ZDB-MRPHLNO-090714-2
- Name
- MO2-upf1
- Previous Names
-
- Upf1 SpliceSite (1)
- Target
- Sequence
-
5' - TTTTGGGAGTTTATACCTGGTTGTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-upf1
No data available
Phenotype
Phenotype resulting from MO2-upf1
1 - 4 of 4
Phenotype of all Fish created by or utilizing MO2-upf1
1 - 5 of 11 Show all
Citations
- Diofano, F., Weinmann, K., Schneider, I., Thiessen, K.D., Rottbauer, W., Just, S. (2020) Genetic compensation prevents myopathy and heart failure in an in vivo model of Bag3 deficiency. PLoS Genetics. 16:e1009088
- Gangras, P., Gallagher, T.L., Parthun, M.A., Yi, Z., Patton, R.D., Tietz, K.T., Deans, N.C., Bundschuh, R., Amacher, S.L., Singh, G. (2020) Zebrafish rbm8a and magoh mutants reveal EJC developmental functions and new 3'UTR intron-containing NMD targets. PLoS Genetics. 16:e1008830
- Slijkerman, R., Goloborodko, A., Broekman, S., de Vrieze, E., Hetterschijt, L., Peters, T., Gerits, M., Kremer, H., van Wijk, E. (2018) Poor Splice-Site Recognition in a Humanized Zebrafish Knockin Model for the Recurrent Deep-Intronic c.7595-2144A>G Mutation in USH2A. Zebrafish. 15(6):597-609
- Gallagher, T.L., Tietz, K.T., Morrow, Z.T., McCammon, J.M., Goldrich, M.L., Derr, N.L., Amacher, S.L. (2017) Pnrc2 regulates 3'UTR-mediated decay of segmentation clock-associated transcripts during zebrafish segmentation. Developmental Biology. 429(1):225-239
- Schuermann, A., Helker, C.S., Herzog, W. (2015) Metallothionein 2 regulates endothelial cell migration through transcriptional regulation of vegfc expression. Angiogenesis. 18(4):463-75
- Wittkopp, N., Huntzinger, E., Weiler, C., Saulière, J., Schmidt, S., Sonawane, M., and Izaurralde, E. (2009) Nonsense-mediated mRNA decay effectors are essential for zebrafish embryonic development and survival. Molecular and cellular biology. 29(13):3517-3528
1 - 6 of 6
Show